Key words
Salvia miltiorrhiza
- Lamiaceae - Radix Salviae Miltiorrhizae - ITS - SNP - allele-specific PCR
Abbreviations
ITS:
internal transcribed spacer
SNP:
single nucleotide polymorphism
RAPD:
random amplified polymorphic DNA
ISSR:
inter-simple sequence repeats
RFLP:
restriction fragment length polymorphism
AFLP:
amplified fragments length polymorphism
SRAP:
sequence related amplified polymorphism
CoRAP:
conserved region amplification polymorphism
Salvia miltiorrhiza Bunge (Lamiaceae) is one of the most widely used traditional Chinese medicinal plants.
The dried root and rhizome of S. miltiorrhiza, known as Radix Salviae Miltiorrhizae (Danshen in Chinese), have been used for the
treatment of various cardiovascular and cerebrovascular diseases for hundreds of years
in Asian countries [1]. Modern pharmacologic studies have demonstrated that Radix Salviae Miltiorrhizae
has additional biological activities including anticancer, anti-inflammatory, antioxidant,
antimicrobial, and antivirus [2]. Due to its comprehensive and remarkable pharmacological activities, especially
its antioxidant capacity, Radix Salviae Miltiorrhizae has become a widely accepted
health-promoting product and worldwide consumption is rapidly increasing [3].
A common problem existing in traditional Chinese medicine materials is that substitutes
and adulterants are often introduced intentionally or accidentally, and Radix Salviae
Miltiorrhizae is no exception. In the Salvia genus, only S. miltiorrhiza is regarded as the botanical source of Radix Salviae Miltiorrhizae in the Pharmacopoeia
of Peopleʼs Republic of China [4]. However, the dried roots of Salvia przewalskii Maxim., Salvia yunnanensis C. H.Wright, Salvia sinica Migo, and Salvia digitaloides Diels are usually mistaken for Radix Salviae Miltiorrhizae in some local areas in
China [5]. Therefore, a simple and reliable method is clearly needed for the accurate identification
of Radix Salviae Miltiorrhizae in order to ensure its clinical efficacy and safety
as well as to protect consumerʼs rights.
Traditional methods based on morphological characteristics for authentication of Radix
Salviae Miltiorrhizae are subjective and error-prone, as Radix Salviae Miltiorrhizae
and its adulterants resemble each other in shape and color [6]. Chemical constituents such as tabshinone and cryptotanshinone are used as identification
markers as well [7], but their contents may be affected by physiological conditions and many Salvia species contain similar chemical components [8]. With the development of molecular biology techniques, DNA markers have become a
popular means for authentication of Radix Salviae Miltiorrhizae. Although several
efforts have been made to develop molecular markers for Salvia species, the discrimination of Radix Salviae Miltiorrhizae from its adulterants is
still an unresolved problem. In this study, we present a simple and reliable method
for identifying genuine Radix Salviae Miltiorrhizae from its adulterants by using
SNP markers and multiplex allele-specific PCR.
Proven to be an ideal DNA barcode for species identification [9], [10], sequences of the nuclear ribosomal ITS region have been evaluated for genotyping
Salvia species [7], [11], [12]. But specific authentication of S. mitiorrhiza from its adulterants was scarcely studied, especially the use of many Salvia species going under the name of Radix Salviae Miltiorrhizae. Therefore, we tried
to establish a simple and reliable DNA method for Radix Salviae Miltiorrhizae authentication.
The compiled ITS sequences of five Salvia species were registered in GenBank with accession numbers of KJ397256–KJ397260. From
the multiple sequence alignment result, as shown in [Fig. 1], a host of SNP sites exist in the ITS region among five Salvia species. However, an SNP site specific for S. mitiorrhiza was discovered neither in the ITS1 region nor in the ITS2 region among five species.
Accordingly, the authentication of Radix Salviae Miltiorrhizae was conducted using
the combination of mutation sites common to two or three species via multiplex allele-specific
PCR.
Fig. 1 Comparison of ITS sequences of five Salvia species.
At the nucleotide positions of 75 bp and 76 bp in ITS1, S. miltiorrhiza, S. sinica, and S. yunnanensis contain nucleotide A and T, while S. przewalskii and S. digitaloides were replaced with T and C in the same positions. These two mutation sites were chosen
to design primer SMR for the former three species mentioned above. Primer SYR was
designed for both S. miltiorrhiza and S. yunnanensis based on the SNP site at the nucleotide position of 538 bp, with an additional mismatch
of A for T. Similarly, primer SSR was designed for specific authentication of S. sinica, with a substitution of G for T, to ensure reliable discrimination ([Table 1]). Additionally, dimmers, hairpins, and false primings are avoided as far as possible
to minimize false positive results and ensure amplification efficiency [13].
Table 1 Primers used in this study.
|
Primer name
|
Nucleotide sequence (5′→3′)
|
Position in ITS
|
|
Bold nucleotides are additional mismatches introduced intentionally
|
|
18SF
|
GGAAGTAAAAGTCGTAACAAGG
|
|
|
26SR
|
TCCTCCGCTTATTGATATGC
|
|
|
SMR
|
GGCGGGGGACCGAGTACAT
|
93–75
|
|
SSR
|
GGGTCGCACGGGAGGCTAT (G→T)
|
463–445
|
|
SYR
|
ACGACGCAGAATCACGACTC(A→T)
|
557–538
|
With the combination of these three primers, as well as the forward primer 18SF, multiplex
allele-specific PCR was performed to identify S. miltiorrhiza from its adulterants. As expected, the combination of three primer pairs generated
different fragment patterns for different Salvia species ([Fig. 3]). S. miltiorrhiza, S. sinica, and S. yunnanensis yielded their specific amplicons of 146 bp, which represents their AT allele. Likewise,
only S. yunnanensis, S. przewalskii, and S. digitaloides could be amplified by primer SYR, with their bands of 608 bp, 610 bp, and 610 bp,
respectively. The fragments of 514 bp, from which S. sinica can be differentiated among the other four species, were produced by primer SSR,
representing its specific A allele. From the fragment patterns, S. miltiorrhiza can be easily discriminated from its four adulterants by its single 146 bp fragment,
which differs from the 610 bp specific bands of S. przewalskii and S. digitaloides. Although S. sinica and S. yunnanensis also generated the 146 bp fragment, they can be clearly identified by their specific
amplicons of 514 bp and 608 bp, respectively. Therefore, the established multiplex
allele-specific PCR system is effective for authentication of S. miltiorrhiza from its adulterants.
Fig. 2 Positions of primers used in this study.
Fig. 3 Multiplex PCR products of five Salvia species. Lane M: 1 kb DNA ladder; lanes 1–3: S. mitiorrhiza; lanes 4–6: S. sinica; lanes 7–9: S. yunnanensis; lanes 10–12: S. digitaloides; lanes 13–15: S. przewalskii.
Due to the potential confusion over which variety of the medicinal plant is called
for in a given situation, accurate authentication is critical for its effective and
safe application. This is particularly true in the context of the Salvia genus in which many species are usually mistaken for Radix Salviae Miltiorrhizae
in some local areas in China. Nowadays, molecular technology provides an independent
approach for the authentication of medicinal plants. Several DNA molecular markers
have been developed for Salvia species, including RAPD [14], AFLP [15], PCR-RFLP [16], SRAP [17], CoRAP [18], and ISSR [19]. However, these methods are not suitable for developing a simple and reliable method
to identify Radix Salviae Miltiorrhizae,mainly due to their sensitivity to PCR temperature
or tedious visualization procedures.
Although SNP site specific for S. miltiorrhiza does not exist in the ITS region, molecular authentication of Radix Salviae Miltiorrhizae
from its adulterants was achieved by SNP genotyping with a multiplex allele-specific
PCR. The introduction of additional mismatches ensured a reliable discrimination between
alleles and multiplex PCR-enabled identification of Radix Salviae Miltiorrhizae. Besides,
the established multiplex allele-specific PCR system enables the simultaneous identification
of four Salvia species in one reaction, requires no sequencing analysis of PCR products, and the
authentication of Radix Salviae Miltiorrhizae only needs a simple agarose gel-based
assay after PCR. Compared with the developed DNA markers for Salvia species, the present method is simple, reliable, and cost-effective. The ITS region
appears in multiple copies in the nuclear genome, and PCR amplification is thus not
appreciably affected by DNA degradation. Therefore, this method is strongly recommended
for the authentication of processed Radix Salviae Miltiorrhizae materials. In this
study, a simple and reliable method for molecular authentication of S. miltiorrhiza from its adulterants was established by SNP genotyping and multiplex PCR. Because
chemical compositions are usually affected by environmental and processing factors,
the present method should be an important tool to complement morphological and chemical
analyses for quality control of Radix Salviae Miltiorrhizae.
Materials and Methods
Plant materials and DNA isolation
The plant samples listed in [Table 2] were collected from different regions of China and identified by Prof. Haizhu Jin,
College of Life Science, Yantai University. All the voucher specimens were deposited
in the Research Institute of Food Science and Technology, Yantai University. The plant
leaves and medicinal materials were frozen in liquid nitrogen and ground into a fine
powder. Genomic DNA was then isolated and purified using a plant DNA isolation kit
(Exgene Tissue SV, GeneAll), according to the manufacturerʼs instructions.
Table 2 Plant samples used in this study.
|
Species
|
Locations
|
Voucher specimen
|
Genbank accession no.
|
|
S. miltiorrhiza
|
Shandong, China
|
SM201301
|
KJ397256
|
|
S. miltiorrhiza
|
Henan, China
|
SM201302
|
|
S. miltiorrhiza
|
Sichuan, China
|
SM201303
|
|
S. sinica
|
Anhui, China
|
SS201301
|
KJ397257
|
|
S. sinica
|
Zhejiang, China
|
SS201302
|
|
S. sinica
|
Hubei, China
|
SS201303
|
|
S. yunnanensis
|
Yunnan, China
|
SY201301
|
KJ397258
|
|
S. yunnanensis
|
Yunnan, China
|
SY201302
|
|
S. yunnanensis
|
Sichuan, China
|
SY201303
|
|
S. digitaloides
|
Yunnan, China
|
SD201301
|
KJ397259
|
|
S. digitaloides
|
Yunnan, China
|
SD201302
|
|
S. digitaloides
|
Yunnan, China
|
SD201303
|
|
S. przewalskii
|
Sichuan, China
|
SP201301
|
KJ397260
|
|
S. przewalskii
|
Yunnan, China
|
SP201302
|
|
S. przewalskii
|
Yunnan, China
|
SP201303
|
Polymerase chain reaction amplification of internal transcribed spacer region and
multiple sequence alignment
The ribosomal ITS region was amplified using forward primer 18SF (5′-GGAAGTAAAAGTCGTAACAAGG-3′)
and reverse primer 26SR (5′-TCCTCCGCTTATTGATATGC-3′). The 20 µL PCR reaction mixture
contained 20 ng of template DNA, 0.5 µM of each primer, and 10 µL of 2X PreMix DNA
polymerase (Genotech). The PCR amplification profile consisted of 1 predenaturation
cycle of 4 min at 94 °C, followed by 35 cycles of denaturation at 94 °C for 30 s,
annealing at 58 °C for 30 s, extension at 72 °C for 30 s, and a final extension at
72 °C for 5 min. PCR products were analyzed by electrophoresis on 1.0 % agarose gel
and then purified with a PCR DNA Purification Kit (GeneAll) as described in the manufacturerʼs
instructions. DNA was sequenced in both directions on an automatic DNA sequencer (ABIPRISM
3700) by using a BigDye Terminator Cycle Sequencing Kit (Applied Biosystems). DNA
sequences were assembled using SeqMan software, and multiple sequence alignments were
conducted using the ClustalW2.0 program [20].
Design of specific primers
Primers were designed based on the SNP sites detected from the multiple alignment
result. The substitutions of G for T in primer SSR and A for T in primer SYR were
introduced deliberately to ensure absolute specificity and reliable discrimination
between alleles [21]. Primer SMR was also designed to perform multiplex PCR with SSR and SYR for Radix
Salviae Miltiorrhizae authentication. The locations of primers used in this study
are shown in [Fig. 2].
Multiplex allele-specific polymerase chain reaction
Three new designed primers, together with the ITS forward primer 18SF, were used for
authentication of Radix Salviae Miltiorrhizae by multiplex PCR. The 20 µL PCR reaction
mixture consisted of 50 ng of DNA template and 10 µL of 2X Premix DNA polymerase (Genotech).
The concentrations of four primers, 18SF, SMR, SSR, and SYR, were 0.5 µM, 0.125 µM,
0.3 µM, and 0.5 µM, respectively. Multiplex PCR was performed using 1 cycle of 4 min
at 94 °C, 33 cycles of 30 s at 94 °C, 30 s at 62 °C, and 30 s at 72 °C with a final
extension at 72 °C for 5 min.
Acknowledgements
The present study was supported by the Shandong Provincial Natural Science Foundation
(ZR2013CQ021) and the Scientific Research Foundation for the Returned Overseas Chinese
Scholars, State Education Ministry.
