Keywords
amoebiasis - coproantigen testing -
Entamoeba histolytica
- amoebic colitis - amoebic dysentery
Introduction
Amoebiasis is caused by the intestinal protozoan parasite Entamoeba histolytica. Owing to the lack of adequate sanitation and increased fecal contamination of water
supplies, this parasitic disease is more commonly seen in developing countries.[1] Apart from cases of E. histolytica infection, there have been other case reports of E. dispar and E. moshkovskii being isolated from patients with gastrointestinal symptoms, but there is no convincing
evidence of a causal association between the isolation of these two species and the
clinical manifestations in the cases reported.[2] Nowadays, it is also observed that Entamoeba moshkovskii is emerging as another protozoan parasite causing infantile diarrhea.[3]
[4]
The fourth leading parasitic cause of mortality worldwide is attributed to amoebiasis
and data reveal that it caused 11,300 deaths globally in the year 2013.[5] Many people get infected with E. histolytica, making amoebic colitis a leading cause of diarrhea, which kills more than 55,000
people each year, owing to its severe complications.[6] In India, approximately 15 to 20% of the population is affected by this protozoan
parasite.[7] The clinical features of amoebiasis range from asymptomatic colonization to extraintestinal
invasive amoebiasis. Usually, the affected cases are asymptomatic, but invasive intestinal
infection also manifests in certain patients, which has a range of clinical features
like chronic abdominal cramps, tenesmus, watery diarrhea or dysentery, and loss of
weight.[8] A prompt diagnosis is crucial for the patients with amoebic dysentery and asymptomatic
cases so as to interrupt the transmission of disease. The laboratory diagnosis of
E. histolytica infection is challenging, and the currently available diagnostic methods lack sensitivity.
In the developing countries, intestinal amoebiasis is usually diagnosed in laboratory
by identifying parasite cysts or motile trophozoites by wet mount examination of the
suspected stool samples. The drawbacks of this conventional method include its low
sensitivity and specificity, with false positive results common, owing to the presence
of other protozoans like E. dispar or E. moshkovskii. Ideally, diagnosis should be framed taking into consideration a combination of laboratory
testing methods, namely the microscopic detection of parasite in stool specimens,
serodiagnosis by detection of E. histolytica-specific coproantigen, and stool polymerase chain reaction (PCR) for detection of
parasite DNA.
The present study aimed to comparatively analyze the currently used different diagnostic
modalities for the detection of E. histolytica from stool sample of patients clinically diagnosed with intestinal amoebiasis.
Materials and Methods
This cross-sectional study was conducted from January 2017 to December 2019 in a tertiary
care hospital, Puducherry, south India. Ethical approval for the study was obtained
from the Jawaharlal Institute of Postgraduate Medical Education & Research (JIPMER)
Institute ethics committee. Considering a prevalence of E. histolytica as 4.5% with 1.35 absolute precision, the calculate sample size for the study was
734. We have included all eligible patients visited outpatient department (OPD) during
the study period.
A group of 631 participants included in the study and their results were analyzed.
All the subjects who reported to the hospital OPD with complaints of abdominal pain,
vomiting, diarrhea, dysentery, indigestion, flatulence, dehydration, and weight loss
were included. The cases with suspected bacterial causes of gastroenteritis and noninfectious
etiology were excluded from the study. About 5 to 8 g of stool sample was collected
in a 25 mL, sterile, screw-capped container, on 3 consecutive days from each patient.
A written informed consent was obtained from all the study participants. A detailed
history of prior treatment with any antiamoebic drugs or antibiotics was taken at
the time of collection of stool samples from the clinically suspected patients. The
unpreserved stool samples were transported to the laboratory for processing within
1 hour of collection. After reaching the laboratory, macroscopic examination of stool
sample for noting the color, consistency, presence of blood, mucus, etc. was done.
Then, each stool sample was divided into three parts. The first part was used for
direct wet mount examination and formol ether sedimentation concentration method,
according to Garcia et al.9 The second and third part of stool sample were stored at –20°C for coproantigen detection
by enzyme-linked immunosorbent assay (ELISA) and PCR, respectively.
Direct Stool Microscopy
Fresh unpreserved stool samples were subjected to a wet mount examination in 0.9%
saline and Lugol's iodine. Each wet mount was microscopically examined for pus cells,
mucus flecks, red blood cells and for the presence of E. histolytica quadrinucleate cysts and trophozoites. The trophozoites of a typical E. histolytica are approximately 20 to 30 µm in diameter. It has a nucleus containing a central
endosome, peripheral chromatin deposition, and radial achromatic fibrils, which gives
the appearance of “cart-wheel” morphology. The serial stepwise motility of E. histolytica trophozoite from a patient sample is demonstrated in [Fig. 1A]. Mostly, the mature parasite cysts are spherical, quadrinucleate, and measure approximately
10 to 15 µm in diameter ([Fig. 1B]). The stool samples were also concentrated by formol-ether sedimentation technique,
by the procedure given by Garcia et al,[9] where wet mount was inconclusive or negative. Apart from a standard wet mount, the
stool specimens were subjected to a modified iron-hematoxylin staining.
Fig. 1 (A,B,C) The serial stepwise locomotion images of a motile Entamoeba
histolytica trophozoite found in a positive stool sample of a case. (D) The quadrinucleate cyst of E. histolytica found in the stool sample of a positive case.
Coproantigen Detection by ELISA
All the second part of patient’s stool samples was batched and E. histolytica ELISA was performed once a week. Each stool sample was subjected to coproantigen
detection ELISA according to the manufacturer’s instructions (Savyon Diagnostics Ltd,
Israel). For detection of antigen in each stool sample, 100 μL of diluted stool specimen
was added to one of the antibody-coated microtiters well of the plate. It was incubated
for 1 hour at 37°C and washed. Then, 100 μL of horseradish peroxidase-conjugate was
added and incubated for 1 hour at 37°C and washed. After that, 100 μL of 3,3′,5,5′-tetramethylbenzidine-substrate
was added, incubated for 15 minutes at room temperature. The reaction was terminated
by addition of 100 μL of stop solution. Finally, the absorbance was read at 450 nm
using an ELISA reader. According to the manufacturer's instructions, a test was considered
positive when the optical density reading of a sample was > 0.15 at 450 nm. The kit
had a sensitivity of 100% and specificity of 95.4%.
Nested Multiplex PCR
The third part of each stool sample was subjected to nested multiplex PCR targeting
the 16S-like rRNA gene for simultaneous detection and differentiation of E. histolytica, E. moshkovskii, and E. dispar, according to the method given by Khairnar and Parija.[10] The parasite nucleic acid extraction from the stool specimens was performed by a
cetyltrimethylammonium bromide extraction method. The extracted DNA was then quantified
in a spin column and purified DNA extract from stool specimens was determined by ultraviolet
(UV) absorbance using a double beam spectrophotometer. The genus-specific primers
sequences used for the first PCR were E-1 5′ TAAGATGCACGAGAGCGAAA 3′ (forward primer)
E-2 5′ GTACAAAGGGCAGGGACGTA 3′ (reverse primer). The species-specific primer sequences
used in the second nested PCR were E. histolytica species EH-1 5′ AAGCATTGTTTCTAGATCTGAG 3′ (forward primer) EH-2 5′ AAGAGGTCTAACCGAAATTAG
3′ (reverse primer), E. moshkovskii species Mos-1 5′ GAAACCAAGAGTTTCACAAC 3′ (forward primer) Mos-2 5′ CAATATAAGGCTTGGATGAT
3′ (reverse primer), and E. dispar species ED-1 5′ TCTAATTTCGATTAGAACTCT 3′ (forward primer) ED-2 5′ TCCCTACCTATTAGACATAGC
3′ (reverse primer), respectively. For a reaction volume of 25 μL, comprising 2.5
μL of 10XPCR buffer (Biogene), 1.5 μL of 25 mM MgCl2 (Bangalore Genei Ltd), 1.4 μL of deoxynucleoside triphosphate mix (5mM each dNTP,
ABgene), 0.3 μL (5 IU/μL) of Taq polymerase (Biogene Ltd), 0.3 μM of each primer (IDT) and 2.5 μL of template DNA
was added in genus-specific and species-specific PCR. The PCR reaction tubes were
then placed in a thermal cycler. The PCR mix underwent an initial denaturation at
96°C for 2 minutes, followed by 30 cycles of PCR. Each amplification cycle consisted
of 92°C for 60 seconds (denaturation), 56°C for 60 seconds (annealing), and 72°C for
90 seconds (extension). Finally, one cycle of extension at 72°C for 7 minutes was
performed. In the species-specific nested multiplex PCR (which had multiple primer
sets in the same tube), only the annealing temperature was modified. About 3 μL of
the amplification products were subjected to electrophoresis through 1.8% agarose
gel at 120 V for 45-minute duration, and were visualized by ethidium bromide dye staining
under UV light, for bands of target DNA detected. The PCR product giving bright band
at 439 bp was considered positive for E. histolytica, whereas all other bands were taken as negative for E. histolytica ([Fig. 2A,B]). Among the other bands, the PCR product giving bright bands at 553 and 174 bp was
considered positive for E. moshkovskii and E. dispar, respectively. Positive and negative control reactions were included with each batch
of samples analyzed by nested multiplex PCR. The positive control used for Entamoeba
and the individual species were an inhouse designed positive controls, obtained after
sequencing the highly conserved region. A negative sample, which was proven PCR negative,
was used as the negative control. The nested multiplex PCR detected E. histolytica, E. dispar, and E. moshkovskii DNA at a rate of 1,000 parasites/0.05 g of feces. The detection limit of nested multiplex
PCR for E. histolytica was 25 Entamoeba protozoa cells.
Fig. 2 Amplified products of PCR were analyzed by agarose gel electrophoresis. The size
of the amplification product is indicated on the right (in base pairs). Samples 1
and 2 are negative for Entamoeba histolytica and the PCR products showing the bright band at 439 bp (samples 29 and 30) are positive
for E. histolytica, along with the positive and negative controls used for the nested multiplex PCR.
NTC, no template control; NEC, negative extraction control; PC, positive control;
PCR, polymerase chain reaction.
Statistical Analysis
The study data for analysis were entered into Microsoft Excel sheet. The three diagnostic
tests done were statistically analyzed, taking microscopy as the gold standard. The
agreement between techniques (microscopy, coproantigen ELISA and PCR) was analyzed
with kappa statistics. Sensitivity, specificity, positive predictive value (PPV),
negative predictive value (NPV), and diagnostic accuracy were summarized as percentage
with 95% confidence interval. All the statistical analysis was performed with IBM
SPSS Statistics 20 and Open Epiversion 3.01 software.
Results
A total of 631 patients participated in the study. The unpreserved stool samples from
all the 631 patients were subjected to three different diagnostic modalities for diagnosis
of Entamoeba spp. infections. The three tests used were stool microscopy, coproantigen
ELISA, and nested multiplex PCR. A positive result obtained in any one of the above
three diagnostic tests used was considered as a positive case. Among the 631 patients,
33 (5.2%) patients were positive for E. histolytica infection. The multiplex PCR results revealed 30 (4.7%) cases to be positive for
E. histolytica, 9 (1.4%) cases to be positive for Entamoeba dispar, and 3 (0.4%) cases to be positive for E. moshkovskii cysts in stool sample of patients. These two species, that is, E. dispar and E. moshkovski
i, were not included for analysis.
Among the Entamoeba histolytica infection cases, analysis of the different diagnostic techniques used showed that,
stool microscopy was positive in 20 (3.17%) cases and negative in 611 (96.83%) cases,
coproantigen ELISA was positive in 29 (4.6%) cases and negative in 602 (95.4%) cases,
and multiplex PCR was positive in 30 (4.75%) cases and negative in 601 (95.25%) cases
([Table 1]). It was also observed that the most commonly affected age group was between 26
and 45 years and the disease was more prevalent among the male gender ([Table 2]). The individual E. histolytica positive cases were tabulated according to the results obtained by the diagnostic
method results used ([Table 3]). Further, the percentage shows the % positivity among the three stool samples collected
from each positive case ([Table 3]).
Table 1
Result showing the comparative performance of different diagnostic methods (n = 631)
|
Result
|
Microscopy
|
%
|
Serology by coproantigen ELISA
|
%
|
PCR
|
%
|
|
Positive
|
20
|
3.17
|
29
|
4.60
|
30
|
4.75
|
|
Negative
|
611
|
96.83
|
602
|
95.40
|
601
|
95.25
|
Abbreviations: ELISA, enzyme-linked immunosorbent assay; PCR, polymerase chain reaction.
Table 2
Age and sex distribution of the positive cases (n = 33)
|
Age
|
Male
|
%
|
Female
|
%
|
|
0–14
|
1
|
3.03
|
0
|
0
|
|
15–25
|
3
|
9.09
|
1
|
3.03
|
|
26–35
|
5
|
15.2
|
4
|
12.2
|
|
36–45
|
8
|
24.2
|
2
|
6.06
|
|
46–55
|
1
|
3.03
|
3
|
9.09
|
|
> 55
|
5
|
15.2
|
0
|
0
|
|
Total
|
23
|
69.7
|
10
|
30.3
|
Table 3
Matrix showing the result of testing method of each positive cases with % positivity
among the 3 stool samples of each case (n = 33)
|
Sl. no.
|
Microscopy
|
ELISA
|
PCR
|
|
1
|
+ (100%)
|
+ (100%)
|
+ (100%)
|
|
2
|
+ (100%)
|
+ (100%)
|
+ (100%)
|
|
3
|
+ (100%)
|
+ (100%)
|
+ (100%)
|
|
4
|
+ (66.6%)
|
–
|
+ (66.6%)
|
|
5
|
+ (66.6%)
|
+ (66.6%)
|
+ (66.6%)
|
|
6
|
–
|
+ (66.6%)
|
+ (66.6%)
|
|
7
|
–
|
+ (66.6%)
|
–
|
|
8
|
–
|
–
|
+ (66.6%)
|
|
9
|
+ (100%)
|
+ (100%)
|
+ (100%)
|
|
10
|
+ (100%)
|
+ (100%)
|
+ (100%)
|
|
11
|
+ (100%)
|
+ (100%)
|
+ (100%)
|
|
12
|
+ (66.6%)
|
–
|
+ (66.6%)
|
|
13
|
+ (100%)
|
+ (100%)
|
+ (100%)
|
|
14
|
–
|
+ (66.6%)
|
–
|
|
15
|
–
|
+ (66.6%)
|
+ (66.6%)
|
|
16
|
–
|
–
|
+ (66.6%)
|
|
17
|
+ (100%)
|
+ (100%)
|
+ (100%)
|
|
18
|
–
|
+ (66.6%)
|
–
|
|
19
|
+ (100%)
|
+ (100%)
|
+ (100%)
|
|
20
|
+ (100%)
|
+ (100%)
|
+ (100%)
|
|
21
|
+ (100%)
|
+ (100%)
|
+ (100%)
|
|
22
|
+ (100%)
|
+ (100%)
|
+ (100%)
|
|
23
|
+ (100%)
|
+ (100%)
|
+ (100%)
|
|
24
|
+ (100%)
|
+ (100%)
|
+ (100%)
|
|
25
|
+ (100%)
|
+ (100%)
|
+ (100%)
|
|
26
|
–
|
+ (66.6%)
|
+ (100%)
|
|
27
|
–
|
+ (66.6%)
|
+ (100%)
|
|
28
|
–
|
+ (100%)
|
+ (100%)
|
|
29
|
+ (100%)
|
+ (100%)
|
+ (100%)
|
|
30
|
+ (100%)
|
+ (100%)
|
+ (100%)
|
|
31
|
–
|
+ (66.6%)
|
+ (66.6%)
|
|
32
|
–
|
+ (100%)
|
+ (100%)
|
|
33
|
–
|
+ (100%)
|
+ (100%)
|
Abbreviations: ELISA, enzyme-linked immunosorbent assay; PCR, polymerase chain reaction.
The statistical analysis was done, taking microscopy as the gold standard. The statistical
agreement between microscopy and coproantigen ELISA was found to be 0.79, using kappa
statistics with 95% confidence interval ([Table 4]). The validity indicators of coproantigen ELISA against microscopy showed a sensitivity
of 90%, specificity of 98.2%, PPV of 62.07%, NPV of 99.67%, and a diagnostic accuracy
of 97.94% ([Table 5]). The statistical agreement between microscopy and PCR was found to be 0.72, using
kappa statistics with 95% confidence interval ([Table 6]). The validity indicators of PCR against microscopy showed a sensitivity of 100%,
specificity of 98.36%, PPV of 66.67%, NPV of 100%, and a diagnostic accuracy of 98.42%
([Table 7]).
Table 4
Agreement between gold standard (microscopy) and ELISA
|
ELISA
|
Microscopy
|
Kappa
(95% CI)
|
|
Positive
|
Negative
|
|
Positive
|
18
|
11
|
0.79 (0.72–0.87)
|
|
Negative
|
2
|
600
|
|
Total
|
20
|
611
|
|
Abbreviations: CI, confidence interval; ELISA, enzyme-linked immunosorbent assay.
Table 5
Validity indicators of ELISA against microscopy
|
Parameter
|
Estimate (95% CI)
|
|
Sensitivity
|
90
|
|
Specificity
|
98.2
|
|
PPV
|
62.07
|
|
NPV
|
99.67
|
|
Likelihood ratio positive test
|
49.99
|
|
Likelihood ratio negative test
|
0.1018
|
|
Diagnostic accuracy
|
97.94
|
Abbreviations: CI, confidence interval; NPV, negative predictive value; PPV, positive
predictive value.
Table 6
Agreement between gold standard (microscopy) and PCR
|
PCR
|
Microscopy
|
Kappa
(95% CI)
|
|
Positive
|
Negative
|
|
Positive
|
20
|
10
|
0.72 (0.65–0.80)
|
|
Negative
|
0
|
601
|
|
Total
|
20
|
611
|
|
Abbreviations: CI, confidence interval; PCR, polymerase chain reaction.
Table 7
Validity indicators of PCR against microscopy
|
Parameter
|
Estimate (95% CI)
|
|
Sensitivity
|
100
|
|
Specificity
|
98.36
|
|
PPV
|
66.67
|
|
NPV
|
100
|
|
Likelihood ratio positive test
|
61.1
|
|
Likelihood ratio negative test
|
0.0
|
|
Diagnostic accuracy
|
98.42
|
Abbreviations: CI, confidence interval; NPV, negative predictive value; PCR, polymerase
chain reaction; PPV, positive predictive value.
Discussion
The present study detected 5.2% cases to be positive for E. histolytica among a total of 631 patients tested over a duration of 3 years. This study showed
male gender was more commonly affected, belonging to the age group 26 to 45 years.
Similar findings were also noted by Tharmaratnam et al and Kantor et al in their study.[4]
[11]
From the very old days, the laboratory diagnosis of E. histolytica has always been based on direct microscopic examination of stool samples showing
distinct protozoan morphology.[12] Currently, however, usage of the direct microscopy-based identification techniques
to differentiate among protozoa with similar morphological features like E. coli, E. moshkovskii, E. dispar, and E. hartmanni is seemingly unreliable.[2] There is a vast diversity in the morphological appearances of the cysts and trophozoites
of Entamoeba species. Therefore, the confirmed identification of these intestinal parasites requires
observation by a skilled microscopist. Moreover, various studies prove that the sensitivity
and specificity of conventional microscopy, on a single stool specimen, for distinguishing
the various species of Entamoeba are far less than reliable.[13]
[14] In fresh wet mount preparation, the locomotion of E. histolytica in fresh preparations usually occurs linearly, with the clear hyaline ectoplasm flowing
to form blunt-ended pseudopodia, then leading the granular endoplasm containing the
nucleus to flow in the same direction.[15] At times, when a fresh stool specimen cannot be examined immediately, it may be
preserved with a fixative like polyvinyl alcohol or maintained at 4°C temperature.
Stool specimens can be examined either unstained or stained with Lugol's iodine. Iodine
increases the contrast and improves the clarity of internal structures like nucleus
of the parasite. Wheatley's trichrome staining or modified iron hematoxylin stains
for permanent smears have been suggested as better stains for regular use in the diagnosis
of E. histolytica or E. dispar.[16]
[17]
[18] There are several factors that adversely affect the results of microscopy. These
include lack of trained microscopists; delayed transport of sample to the laboratory;
difficulty in differentiation between nonmotile trophozoites and polymorphonuclear
leukocytes or macrophages; inappropriate sample collection; interfering substances
such as antibiotics, purgatives, antacids, cathartics, antidiarrheal preparations
(kaolin or bismuth), or enemas; inadequate number of specimens collected (at least
three specimens are needed due to intermittent shedding nature of the parasite cyst);
lack of preservation of stool specimens with fixatives; and presence of other commensal
amoebae.[19] CDC guidelines say that multiple stool samples (at least 3) should be tested before
a negative result is reported, and stool samples in formalin, or other fixatives,
need to be concentrated prior to microscopic examination[20] and finally the choice of diagnostic techniques should depend on available equipment
and reagents, experience, and considerations of time and cost.
In the present study, it was observed that coproantigen ELISA was positive in 29 (4.6%)
cases and negative in 602 (95.4%) cases. The validity indicators of coproantigen ELISA
against microscopy showed a sensitivity of 90%, specificity of 98.2%, PPV of 62.07%,
NPV of 99.67%, and a diagnostic accuracy of 97.94%. This is similar to the study findings
by el-Hamshary et al and Bayoumy et al, where they have concluded that coproantigen
assay using ELISA is more sensitive and specific than microscopy even when the parasitic
count is low, thus reducing the chances of missing positive cases even in the asymptomatic
cases and widespread use of this technique has allowed for revising the epidemiology
of the true pathogenic E. histolytica, thus eliminating the need for unnecessary treatment.[21]
[22] These tests may be helpful from a diagnostic perspective in developed nations, where
infections due to E. histolytica are not very commonly seen. The coproantigen detection ELISA is more useful as an
adjunct to microscopic diagnosis in detecting intestinal parasites, than antibody
detection ELISA. Recent studies reveal regarding the high sensitivity and specificity
of fecal antigen assay with the use of polyclonal or monoclonal antibodies that can
successfully detect Entamoeba infections, which are negative by stool microscopy.[23]
[24] These antigen-based detection tests have a sensitivity approaching that of stool
culture.[2] A good sensitivity and specificity have been observed for tests detecting of E. histolytica antigen in stool specimens, especially in patients with amoebic colitis and asymptomatic
cases.[25] Importantly, among the routinely used diagnostic methods, that is, antigen detection,
antibody detection, microscopy, and isoenzyme analysis, PCR., only coproantigen detection
using ELISA is technically simple to perform and can be used in resource poor settings
that do not have molecular facilities, thus making it appropriate for use in the developing
world, where amoebiasis is more commonly seen.[26] The only drawback of this coproantigen testing is that it can be performed only
on unpreserved fresh or frozen stool samples, since fecal antigens get destroyed by
fixative agents.[27] Also, sensitivity of coproantigen tests is lower than molecular methods of detection.[28]
Due to the many limitations of the conventional techniques, molecular methods of detection
are emerging as a handy tool in the diagnosis of various infections including amoebiasis.
The accurate identification of pathogenic E. histolytica is essential in the treatment of the affected patients as well as studying the epidemiology
of amoebiasis outbreaks. The World Health Organization also recommends the application
of PCR technology for the accurate detection and differentiation of E. histolytica from other commensal amoebae, directly from stool samples.[2] Blessmann et al developed a closed tube real-time PCR to detect E. histolytica directly from stool samples. They concluded in their study that the two sets of primers
are actually species specific and that PCR is not influenced by the presence of considerable
amounts of other Entamoeba species.[29] In the current study, the nested multiplex PCR technique was used for the detection
of E. histolytica directly from stool sample, by the method given by Khairnar and Parija.[10] This nested multiplex PCR detected E. histolytica, E. dispar, and E. moshkovskii DNA, even at the minimum parasite concentration tested (1,000 parasites/0.05 g of
feces). The detection limit of this PCR for E. histolytica, E. dispar, and E. moshkovskii was approximately 25 Entamoeba protozoa cells. In the present study, it was observed that the nested multiplex PCR
was positive in 30 (4.75%) cases and negative in 601 (95.25%) cases for E. histolytica. The possible causes of PCR negative samples among the serology positive cases might
be attributable to very low parasite density in stool or an extraintestinal infection.
The validity indicators of PCR against microscopy showed a sensitivity of 100%, specificity
of 98.36%, PPV of 66.67%, NPV of 100%, and a diagnostic accuracy of 98.42%. This is
similar to the study findings by Blessmann et al.[29] In comparison to microscopy or coproserology, PCR detected slightly higher number
of positive samples, suggesting that PCR is more sensitive than either of those techniques.
The study by Weitzel et al study suggests that PCR testing would be a great aid in
the laboratory diagnosis of amoebiasis, which will surpass the limitations of conventional
modes of diagnosis of this parasitic disease.[30] In endemic setups, which usually the developing countries are, it is advisable to
perform all the three tests simultaneously, so as to diagnose all the cases and treat
accordingly. But with respect to cost-effectiveness, microscopy and serology can be
performed in all suspected cases and PCR can be done only for cases with strong clinical
suspicion despite a negative microscopy and serology result.
Conclusion
This study throws substantial light on the diagnostic advantages of PCR over the conventional
coproantigen ELISA-based kits and stool microscopy, in both sensitivity and specificity.
In addition, the nested multiplex PCR has the advantage of specifically targeting
and detecting E. histolytica, E. dispar, and E. moshkovskii in clinical stool samples. This study aimed to discuss different methods that exist
for the laboratory identification of E. histolytica. After statistical analysis of the observations from the present study, it is thus
concluded that in all cases of clinically suspected amoebiasis, preferably a combination
of stool microscopy, stool coproantigen testing followed up by molecular detection
of the parasite DNA from stool samples offers the best and robust approach to laboratory
diagnosis of E. histolytica.
Informed Consent
Written informed consent was taken from all adult participants and parents of minor
participants, who agreed to be enrolled in the study group, after getting approval
from the JIPMER Ethical Committee, JIPMER.
Authors’ Contribution
Sindhusuta Das was responsible for sample and data collection, and its processing
including microscopy, coproELISA, and PCR. She was responsible for writing the manuscript
and its submission. Nonika Rajkumari was responsible for the conceptualization of
the study, counterchecking the results, and monitoring of the work performed and analysis
of the results. She also checked and refined the manuscript and gave critical inputs
to the paper. Anitha Gunalan helped in data collection and initial data processing.
Dhanalakshmi Rajavelu helped in data collection and the figure refinement. Jeby Jose
Olickal helped in the statistical modeling of the study selection of the study parameters
as well as gave critical inputs to the study and helped in refining the final manuscript.
