Keywords
colorectal adenocarcinoma - CRC - LncRNA - TUG1 - PCR
Introduction
Colorectal cancer (CRC) is ranked as the third most common cancer globally and second
in cancer-related mortality. A total of 90% of CRC cases are diagnosed over the age
of 55 years old.[1] It is a multistep malignancy in which genetic and epigenetic alterations accumulate.[2] Genetic diseases are familial adenomatous polyposis (FAP), hereditary non-polyposis
CRC (HNPCC) and Gardner syndrome, while post-translational histone acetylation and
methylation are epigenetic factors.[3] Obesity, smoking, and chronic alcoholism are environmental risk factors.[4]
Noncoding RNAs have been widely studied as biomarkers in the context of many diseases
with a focus on lncRNAs and miRNAs. LncRNAs are nonprotein coding transcripts > 200
nucleotides, that have an epigenetic effect in CRC.[5]
Taurine upregulated gene 1 (TUG1) is a lncRNA (∼ 7.1 kb in length) located on chromosome 11. Previous studies expected
TUG1 to be a new diagnostic biomarker and therapeutic target of certain cancers. TUG1 has been proved to act as a miRNA sponge (ceRNA) to regulate mRNA expression of the
target gene and govern the progression of different cancers such as breast, bladder,
and renal cell carcinoma (RCC).[6]
[7]
[8]
[9]
Several studies demonstrated that TUG1 knockdown in different cancer tissues such as urinary bladder carcinoma and hepatocellular
carcinoma (HCC) suppressed cell proliferation, invasion and EMT.[10]
[11]
[12] Moreover, LncRNA TUG1 has been shown to potentiate cancer metastasis and tumor progression
in gastric carcinoma in ovarian mucinous adenocarcinomas.[10] The previous findings show the regulatory roles of the TUG1 cancer progression. Our work suggests that TUG1 could have a potential role in the epithelial to mesenchymal transition of cancer
in CRC tissue samples.
Materials and Methods
The present study included 65 subjects divided into 3 groups. Group I: 25 nonmetastatic
colorectal adenocarcinoma tissue samples; group II: 25 metastatic (locoregional or
blood born) colorectal adenocarcinoma tissue samples; and group III: 15 matched adjacent
noncancerous healthy tissues. Pathological diagnosis of CRC is performed by biopsy
of the mass suspected of tumor development. Disease extent is determined by imaging.
Staging is done based on the TNM system. All samples were obtained from the Department
of General Surgery, colorectal surgery unit, Alexandria main university hospital.
Samples (∼ 0.4 cm × 0.2 cm of tissue) were excised from cancer tissue and adjacent
noncancerous tissue as control. Each sample was then divided into 2 sections; 1 was
submerged in RNA later (Rnase inhibitor) (ThermoFisher Scientific)[13]; and was kept frozen at - 80°C until use. The samples were fixed in 10% formalin solution for 24 hours. they were
processed for light microscopic study to obtain paraffin blots (Formalin Fixed and
Paraffin Embedded [FFPE]). Five microns of sample thickness were cut and mounted on
glass slide then stained using Hematoxylin and eosin stain ([Fig. 1]).
Fig. 1 Pathological examination (formalin fixed and paraffin embedded [FFPE]).
Each 30-mg tissue sample was homogenized in a 2 ml sterile tube with 700 uL Qiazol
solution using an electric homogenizer at 3,000 rpm.[14]
Total RNA isolation from tissue samples was conducted by using the Qiagen miRNeasy
Mini Kit (Qiagen, CA) according to the instructions of the manufacturer. (ID: 217004).[14] Single-stranded cDNA was synthesized from purified samples of RNA using High-Capacity
cDNA Reverse Transcription Kit. (Applied Biosystems, USA) (Cat. No. 4368814 Archive).[15] The purity and the concentration of RNA were measured at 260, 280 and 230 nm by
using the Thermo Scientific, NanoDrop 2000/2000c Spectrophotometer (USA) Ratios of
A260/A280 and A260/A230 = 1.8–2.1 indicates the high purity of RNA.
Relative quantification of tissue lncRNAs TUG1 genetic expression: real-time polymerase chain reaction (PCR) was performed using
Thermo Scientific Maxima SYBR Green qPCR Master Mix (2X) (Thermo Scientific), and
specific primers for lncRNA TUG1. Sequences used are TUG1 forward primer (5′-CTGAAGAAAGGCAACATC-3′) and reverse (5′-GTAGGCTACTACAGGATTTG-3′).[16] Primers were revised using primer blast system. GAPDH was used as internal control to normalize the expression of TUG1. The used GAPDH forward primer is 5′- GTCTCCTCTGACTTCAACAGCG -3′ and reverse primer is 5′- ACCACCCTGTTGCTGTAGCCAA
– 3′.[17]
Real time PCR was done using Applied Biosystems StepOne Real-time PCR System. (Cat.
No. 4376357).[18]
Reagents were purchased from Applied Biosystems, USA. The calculation of RNAs' expression
was done using the comparative cycle threshold (CT) method (2-ΔΔCT).
Results
For statistical analysis, SPSS Statistics for Windows, Version 17.0 (SPSS Inc, Chicago,
IL, USA) was used. The significance of the differences between the two groups was
estimated with the Student t-test. Multiple group comparisons were analyzed by one-way analysis of variance (ANOVA).
The age of the patients ranged from 40 to 83 years old. Thirty patients were males
with a percentage of 46.15% and 35 were females with percentage 53.85% ([Table 1]).
Table 1
Sex distribution of the 3 studied groups
|
Group I
(n = 25)
|
Group II
(n = 25)
|
Group III
(n = 15)
|
Total
|
|
No.
|
%
|
No.
|
%
|
No.
|
%
|
No
|
%
|
|
Sex
|
|
Male
|
14
|
56.0
|
10
|
40.0
|
6
|
40.0
|
30
|
46.15
|
|
Female
|
11
|
44.0
|
15
|
60.0
|
9
|
60.0
|
35
|
53.85
|
The correlation between sex and tissue TUG1 expression in patients of groups I and
II was statistically insignificant ([Table 2]).
Table 2
Relation between Sex and different measurements in group I and II
|
Sex
|
|
|
Group I
|
Male
(
n
= 14)
|
Female
(
n
= 11)
|
p-value
|
|
TUG1
|
|
Median (Min – Max.)
|
2.83 (1.62–4.40)
|
2.04 (1.74–4.88)
|
0.344
|
|
Sex
|
|
|
Group II
|
Male
(
n
= 10)
|
Female
(
n
= 15)
|
p-value
|
|
TUG1
|
|
|
|
0.605
|
|
Median (Min. – Max.)
|
5.34 (2.09–8.03)
|
4.46 (2.04–7.98)
|
|
p-value for comparing between Male and Female.
Analysis of LncRNA TUG1
To discover the role of TUG1, its level was measured in CRC tissues and corresponding non-cancerous tissues and
results showed that TUG1 was upregulated in CRC tissues with a strong significant difference between patients
of group I and II and the control group (p < 0.001) ([Table 3]
[Fig. 2A]). Also, LncRNA TUG1 expression was significantly higher in patients of group I in comparison with samples
of group II. (p
1 = 0.002). LncRNA TUG1 expression was significantly higher in patients of stage I in comparison with the
control group (Group III) (p
2 < 0.001). A meaningful change was found when comparing the TUG1 expressions in cases of stage II and the control group. (p
3 < 0.001).
Table 3
Comparison between the 3 studied groups according to TUG1 expression
|
Group I
(n = 25)
|
Group II
(n = 25)
|
Group III
(n = 15)
|
p-value
|
|
TUG1
|
|
Min. – Max.
|
1.62–4.88
|
2.04–8.03
|
0.04–3.33
|
< 0.001*
|
|
Median (IQR)
|
2.71 (1.97–3.38)
|
4.46 (2.96–6.44)
|
0.73 (0.49–2.28)
|
|
Sig. bet. groups.
|
P
1 = 0.002*,
P
2 = 0.010*,
P
3 < 0.001*
|
|
Abbreviation: IQR, interquartile range.
*: Statistically significant at P ≤ 0.05.
Group I: Nonmetastatic colorectal adenocarcinoma.
Group II: Metastatic (locoregional and blood born) colorectal adenocarcinoma.
Group III: Noncancerous control colon tissue.
Fig. 2 Expression levels of TUG1, TUG1 was upregulated in CRC tissues with strong significant difference between patients
of group I and II and control group. TUG1 expression was significantly higher in patients of group I in comparison with samples
of group II.
Correlation Studies
-
– Correlation between tissue TUG1 expression and of age, hemoglobin, CEA, and CA19.9 serum levels in patients of group
I were statistically insignificant (p = 0.760, 0.473, 0.507, 0.493, respectively).
-
– Correlation between tissue TUG1 expression and age, hemoglobin, CEA, and CA19.9 serum levels in patients of group
II was statistically insignificant (p = 0.322, 0.719, 0.565, 0.685, respectively) ([Table 4]).
Table 4
Correlation between LncRNA TUG1 and age, hemoglobin, CEA and CA19.9 in Group I & II
|
TUG1
|
|
Group I
|
Group II
|
|
rs
|
p-value
|
rs
|
p-value
|
|
Age (years old)
|
- 0.064
|
0.760
|
0.206
|
0.322
|
|
HB
|
0.150
|
0.473
|
- 0.076
|
0.719
|
|
CA19–9
|
0.139
|
0.507
|
0.121
|
0.565
|
|
CEA
|
0.144
|
0.493
|
- 0.085
|
0.685
|
Abbreviations: HB, hemoglobin.
rs: Spearman coefficient.
*: Statistically significant at p ≤ 0.05.
Group I: Nonmetastatic colorectal adenocarcinoma.
Group II: Metastatic (locoregional and blood born) colorectal adenocarcinoma.
Discussion
Colorectal cancer has become a main health problem and one of the most fatal malignancies,
and its incidence is increasing worldwide. Colorectal cancer is usually accompanied
by distal metastasis (liver or lung), and it is associated with increased mortality
rate.[19] Therefore, there is an urgent necessity to discover the molecular mechanisms of
CRC progression.[20]
Long noncoding RNAs (lncRNAs) are RNAs with a length > 200 nucleotides. They participate
in various biological processes, such as chromatin remodeling, transcriptional activation
or interference, and they are involved in the occurrence of CRC by acting as tumor
suppressor genes and oncogenes.[21]
Several studies have documented a tumor-promotive function of TUG1 in different malignancies, especially CRC. However, the mechanisms by which it exerts
its role in CRC remain undefined.[22]
Our study revealed that TUG1 is upregulated in CRC. Wang et al.[23] reported that the LncRNA TUG1 upregulated in CRC promoted CRC progression and 5-fluorouracil (5-FU) resistance
by sponging miR-197–3p. Also, Shen et al.[24] found that the decrease in LncRNA TUG1 inhibited CRC tumor cell migration, invasion, and EMT, and has a major role in reducing
lung metastasis.
TUG1 plays a main role in regulating different cancer types by functioning as a ceRNA
as in oral squamous cell carcinoma by sponging mir-593–3p as reported by Jiang et al.[25] and, in case of osteosarcoma, Farzaneh et al.[26] expressed that MALAT1 LncRNA has been found to regulate CDK9 expression through sponging miR-206 and it can also interact with miR-202 and promote lung metastasis.
Tian et al. declared that the increase in TUG 1 expression has been shown to enhance CRC cell proliferation, invasion, and EMT in
vitro, through promoting SW620 cell motility by decreasing miR-26a-5p activity and
upregulating MMP-14. Moreover, TUG1 promoted carcinogenesis and EMT in colon cancer by stimulating the P38MAPK/Hsp27
axis.[27]
However, Barbagallo. et al analyzed via RT- PCR the expression of 17 lncRNAs in 20
CRC tissues compared with noncancerous adjacent tissues, and in serum exosomes of
these 20 CRC patients compared with 20 healthy individuals identified 8 ncRNAs (including
TUG1) differentially expressed in tissues while in serum exosomes of CRC patients was
downregulated.[28]
Conclusion
TUG1 was upregulated in CRC tissues and cells. Its effects are on proliferation and apoptosis
of cancer cells. Collectively, the present study demonstrated that TUG1 overexpression induces proliferation and inhibits apoptosis in CRC. This possible
molecular mechanism provides a theoretical basis for the research on lncRNA-directed
therapeutics in CRC.
Recommendations
The diagnostic and prognostic impact of TUG1 in CRC is an interesting area for future studies on a large cohort of patients with
a long-term follow-up. In addition, targeting the downstream TUG1 targets could be an innovative approach toward molecularly based adjuvant therapies
of CRC.
