Endothelial LAT1 (SLC7A5) Mediates S-Nitrosothiol Import and Modulates Respiratory Sequelae of Red Blood Cell Transfusion In Vivo

Keywords

endothelial cells - S-nitrosothiols - adhesion - erythrocyte - respiratory

Introduction

Increased red blood cell (RBC) adhesion to endothelial cells (ECs) has been observed in various clinical states such as sickle cell disease, retinal vein thrombosis, diabetes mellitus, malarial infection, and conventional RBC storage, among other settings.[1] We have identified functional and biochemical changes taking place in the first day of RBC storage that may contribute to a proadhesive and vaso-dysregulatory effect of blood banking. Others and we have demonstrated that the ability of RBCs to export vasoregulatory mediators, including S-nitrosothiols (SNOs) and adenosine triphosphate, declines during RBC storage.[2] [3] [4] The deficiency of SNOs in banked RBCs may in turn contribute to depressed oxygenation in the lung[5] [6] and O₂ delivery to the tissues,[7] in turn contributing to disappointing outcomes after transfusion.[8] SNOs are cysteine thiol adducts of nitric oxide (NO), and can be formed in RBCs in concert with the oxygenation-linked allosteric transition in hemoglobin. We have demonstrated that RBCs export these vasoregulatory SNOs on demand in order to fine-tune regional blood flow and prevent RBC adhesion to the endothelium. Unlike NO itself, SNOs resist scavenging by free or cellular (erythrocytic) hemoglobin.[2] SNOs are required for RBC-dependent hypoxic vasodilation, in which allosterically governed SNO release from RBC hemoglobin (Hb) upon deoxygenation promotes regional blood flow in order to optimize oxygen delivery.[9] [10]

Intracellular SNO accumulation in vascular ECs exposed to S-nitrosocysteine (CSNO) appeared to depend on the activity of the L-type amino acid transporters (LATs),[11] but these studies relied on pharmacological probes, which can act nonspecifically with respect to both cell and protein targets. The “system L” neutral amino acid transporter (LAT) family includes LAT1, encoded by the Slc7a5 gene. SLC7A5 / LAT1 facilitates the cellular import of large (“L”) amino acids (AAs) including branched-chain AAs, and plays an important role in carcinogenesis, cancer-associated angiogenesis,[12] and other processes characterized by accelerated cell proliferation.[13] LAT1 is located in numerous human and mouse cell types, including ECs and RBCs. LAT1-specific transporter inhibitors intended as anticancer therapeutics have been developed, and are in early-phase clinical trials.[14] Cellular uptake of leucine and other branched-chain AAs resulting from the activity of LAT1 can lead to the activation of mammalian target of rapamycin complex (mTORC), in turn promoting cellular differentiation (e.g., in T-lymphocytes).[15] LAT1 expressed in ECs can participate in the cellular import of SNOs, biologically active derivatives of NO. NO and SNOs can act as antiadhesive molecules.[16] [17] [18] Endothelial LAT1 appears to be critical for the uptake of branched-chain AAs across the blood brain barrier,[19] with its deficiency in rats or deletion in mice resulting in abnormal RNA translation and depressed protein synthesis, and (respectively) impaired neurological development[20] or severe neurological abnormalities.[21] Moreover, mutations in LAT1 have been identified in human patients with autism-spectrum disorder traits.[21] In a mouse model of Parkinson's disease, LAT1 expression is decreased, and may contribute to the phenotype (and possibly the modeled human disease) through impaired transport of L-tryptophan, a LAT1 substrate.[22] Cysteine is among the AAs imported via LAT1, and the nitrosylated Cys derivative S-nitroso-L-cysteine (“CSNO” or L-CSNO, but not D-CSNO) is also conducted by LAT1.[23] [24] Cellular uptake of CSNO by LATs is selective for the L-isomer of CSNO, and LAT1 may thus represent a filter for stereoselective SNO activities.[25] Interestingly, AA competition studies indicate that (L)-CSNO more effectively competes with leucine for uptake via LAT1 than does Cys itself, suggesting that LAT1 may play a role in cellular CSNO uptake.

We previously demonstrated that LAT1 is a conduit for the export of SNOs from RBCs and identified, using pharmacologic approaches, a novel mechanism whereby RBCs normally export NO-derived signals to the vasculature.[5] Furthermore, we demonstrated the role of LAT1 in SNO export from RBCs and in thereby modulating SNO-sensitive RBC–EC adhesion.[5] But in the absence of a genetic model of LAT1 deficiency, the role of endothelial SNO import in this modulatory effect on RBC–EC adhesion was unknown.

In order to understand the physiological role of LAT1-mediated SNO transport in vivo and determine whether LAT1-mediated SNO import by ECs is necessary for the RBC SNO-induced antiadhesive effect in vivo, we generated a transgenic mouse line in which the gene encoding Slc7a5 includes LoxP sites, flanking exon 3 of the Slc7a5 gene. These LoxP sites are targets of Cre recombinase. When and where Cre is present, it excises the LoxP-flanked part of the gene to suppress Slc7a5/LAT1 expression in mice containing both LAT1-floxed and Cre transgenes. Here, we investigated the function of LAT1 in mice using (endothelial) cell-specific and time-specific LAT1 knockdown (LAT1^fl/fl; Cdh5-Cre^ERT2) in mice in order to determine the importance of SNO imported by EC LAT1 in the modulation of RBC–EC adhesion.

Materials and Methods

Reagents and Mice

Reagents were sourced as noted below. Mouse experiments were approved by the Durham VAHCS or Duke University Animal Care and Use Committee. C57BL/6J mice (Strain 000664) and FLPeR (B6.129S4-Gt(ROSA)26Sor^tm1(FLP1)Dym/RainJ) mice (Strain 009086) were purchased from The Jackson Laboratory (Maine, United States). Floxed LAT1 mice (LAT1^fl/fl) were generated and bred at Duke University as described below. Cadherin 5 (Cdh5)(PAC (P1-derived artificial chromosome)-Cre^ERT2 (henceforth denoted as Cdh5-Cre) mice were obtained as a kind gift from Dr. Ralf Adams (Münster, Germany).[26] Mice of both sexes were used, and the numbers of male and female mice are balanced (within n = 1) except where otherwise noted (see figure legends for n for each in those cases).

Generation of Inducible, Endothelial Cell-Specific LAT1 (Slc7a5) Knockout Mice

A targeting vector for generation of LAT1 targeting in mice was created by BAC recombineering.[27] We designed a targeting vector containing 10 kb of homology of the LAT1 gene Slc7a5, and with loxP sites flanking exon 3 as shown in [Fig. 1]. The construct was electroporated into G4 mouse embryonic stem (ES) cells (obtained as a kind gift from Andras Nagy, Sinai Health),[28] and those with homologous recombination of the Slc7a5 transgene were identified by long-range polymerase chain reaction (PCR) using primers listed in [Table 1]. The PCR-positive clones were then confirmed by Southern blot. The correctly targeted ES clones were expanded and injected into ICR (Institute for Cancer Research)-strain mouse morulae and transplanted into the uteri of pseudopregnant ICR-strain female mice to yield chimeric founder mice. Germline transmission was achieved by mating male chimeric founders with C57BL/6J female mice. The chimeric mice with proven germ line transmission ability (LAT1^fl-neo) were bred with FLPeR mice to remove the FRT-flanked neo expression cassette, and then backcrossed to C57BL/6J mice to exclude the FLP allele, producing floxed LAT1 mice (LAT1^fl/fl), then backcrossed with C57BL/6J mice for eight or more additional generations. The inducible EC-specific LAT1 knockout mouse line was generated by crossing LAT1^fl/fl mice with Cdh5-Cre mice to obtain control LAT1^fl/fl; Cdh5-Cre⁻ mice and LAT1^fl/fl; Cdh5-Cre⁺ littermates. To induce Cre recombinase in ECs and thereby inactivate the LAT1 gene, 8-week-old mice (both groups) received intraperitoneal (i.p.) injections of tamoxifen (MilliporeSigma, Cat. T5648, dissolved in corn oil at a concentration of 20 mg/mL) daily for 5 consecutive days to induce Cre/LoxP-mediated gene deletion; injection dose was determined by weight, approximately 75 mg tamoxifen/kg body weight. Mice were used 6 to 11 days (as indicated) following the last day of tamoxifen treatment.

Fig. 1 Targeting construct and screening strategies. LoxP and FRT restriction sites are shown. The neomycin (Neo) resistance gene cassette (flanked by the FRT sites) and HSV thymidine kinase used for positive and negative selection, respectively, are indicated. Exon 3 of Slc7a5 was targeted. HSV, herpes simplex virus.

Table 1 Sequences of DNA primers for transgenic construct and for genotyping Slc7a5 transgenic mice

Oligo	Use		Primer (5′-3′ sequence)
1	3′ Short Arm PCR	ESNeo.S	CTATCGCCTTCTTGACGAGTTCTTC
		Lat1.AS3	CAG GCA GGA CCA CGT GGT ACA CTC
2	5′ Long Arm PCR	Lat1.S3	CTGCCAGGATCAGGCTCTTTGAAG
		LoxP.AS	AAG GGT TAT TGA ATA TGA TCG GAA TTG G
3	PCR across 5′ LoxP site		Forward: TCCTGGCTCTTGTCAGTTCAC
			Reverse: CTG ACC ACC TAC CTC CTA CAC
4	LAT1-LoxP		Forward: TCC TGG CTC TTG TCA GTT CAC
			Reverse: CTG ACC ACC TAC CTC CTA CAC
5	FLPeR Mutant		Forward: CAC TGA TAT TGT AAG TAG TTT GC
			Reverse: CTA GTG CGA AGTAGT GAT CAG G
6	FLPeR Wild-type		Forward: TGT TTT GGA GGC AGG AAG CAC TTG
			Reverse: AAA TAC TCC GAG GCG GAT CAC AAG
7	Frt-neo	ESNeo.S:	CTATCGCCTTCTTGACGAGTTCTTC
		Lat1.451AS:	GGT GTG GTG TTT GAA TGA GAT C
8	Neomycin cassette		Forward: AGGATCTCCTGTCATCTCACCTTGCTCCTG
			Reverse: AAGAACTCGTCAAGAAGGCGATAGAAGGCG
9	Floxed exon 3	cKO.S	TAACTAAGCCTCAGGAAGGTCATC
		cKO.AS	CAG CAGCAG CAC ACT GAT TGT GAC
10	Cdh5-Cre		Forward: AAT CTC CCA CCG TCA GTA CG
			Reverse: CGT TTT CTG AGC ATA CCT GGA
11	Beta-actin		Forward: TGAGGCTGGTGATAAGTGG
			Reverse: GCGTGAGGGAGAGCATAG

Table 2 Sequences of primers used to quantify mRNA by PCR (Q-PCR analysis)

Gene	Primer (5′-3′ sequence)
β-actin forward	CCGCGAGCACAGCTTCTT
β-actin reverse	CCACGATGGAGGGGAATACA
Slc7a5 Ex3 forward	TGATGCGTCCAACCTGCAGCAG
Slc7a5 Ex5 reverse	GTCAGCATCTGGTTGGTAGAGAG

Abbreviations: PCR, polymerase chain reaction; Q-PCR, quantitative PCR.

Genotyping of Mice by PCR

Three sets of primers were used to genotype (in tail biopsies) with respect to LAT1 targeting, Cdh5-Cre and LAT1 deletion ([Table 1]). The PCR program was 95° C for 2 minutes, followed by 95°C for 30 seconds, 58°C for 30 seconds, and 72°C for 1 minute for 35 cycles. PCR products were resolved on 2% (w/v) agarose gels containing SYBR Safe DNA Stain (Invitrogen) in TAE buffer and imaged under UV light.

Mouse Lung Endothelial Cells Isolation

One week after the last i.p. injection of tamoxifen, 10-week-old mice of either sex were euthanized humanely by bilateral thoracotomy under anesthesia with ketamine/xylazine (100 and 10 mg/kg, respectively, i.p.). Mouse lungs were harvested. After perfusing the lungs free of blood with ice-cold phosphate-buffered saline (PBS), lung tissue was cut into small pieces, and then placed in a gentleMACS C tube (Miltenyi Biotec, Cat. 130-093-237) in 8 mL of lung digestion solution containing collagenase A (1.5 mg/mL, MilliporeSigma, Cat. 11088793001), DNase I (0.4 mg/mL, MilliporeSigma, Cat. 10104159001), 5% FBS and 10 mM HEPES in HBSS. Lung tissue was dissociated into cells using a MACS dissociator (Miltenyi Biotec, Cat.130-093-235). First, 168 rotations were performed in 37 seconds. The tissue fragments were incubated in digestion buffer in a 37°C water bath for 30 minutes, then 2,083 rotations were performed in 38 seconds in the dissociator to finish the homogenization of tissue and disperse the cells. The cells were filtered through a sterile 40 μm cell strainer, and centrifuged at 500 × g for 10 minutes followed by removal of the supernatant. Pelleted cells were resuspended in PBS-based wash buffer containing 0.1% BSA, 2 mM EDTA, then centrifuged at 250 × g for 5 minutes followed by removal of the supernatant. For isolation of ECs with Dynabeads conjugated with anti-rat IgG (ThermoFisher, Cat. 11035), we followed the manufacturer's instructions. Briefly, 200 μL of sheep anti-rat IgG Dynabeads were precoated with 10 μg of rat anti-mouse CD31 (BD Biosciences, Cat. 553369), rat anti-mouse CD41 (BD Biosciences, Cat. 553847), and rat anti-mouse CD45 (BD Biosciences, Cat. 553076) separately. 50 μL of precoated CD41 and CD45 Dynabeads were added to 1 mL of the cell suspension, then incubated 30 minutes (depletion) at 4°C with gentle rotation, enabling negative selection by magnetic cell separation using DynaMag-2 Magnet (Invitrogen, Cat. 12321D). Then, 50 μL of precoated CD31 Dynabeads were added to 1 mL of the CD41-negative and CD45-negative cell population for 20 minutes at 4°C with gentle rotation in order to positively select ECs by magnetic cell separation using the same separator. Magnetically selected CD41⁻CD45⁻CD31⁺ mouse lung ECs (MLECs) without bead release were used for downstream molecular studies of RNA and protein.

Quantitative Real-Time Reverse-Transcriptase PCR

The isolated CD41⁻CD45⁻CD31⁺ MLECs were lysed in TRIzol (Invitrogen, Cat. 15596026). RNA was reverse-transcribed to cDNA with a SuperScript III First-Strand Synthesis System (Invitrogen, Cat. 18080051) as instructed by the manufacturer. Slc7a5 and beta-actin PCRs were performed with primers given in Table 2, and using 95°C for 2 minutes, then 35 cycles of: (95°C for 30 seconds, 60°C for 30 seconds, 72°C for 1 minute) to amplify transcripts. Each experimental cDNA was measured in triplicate. The results were analyzed using the Bio-Rad CFX Manager software. The relative differences in Slc7a5 transcripts were first quantified by the 2^−∆∆Ct method, then normalized to beta-actin.

Western Blotting

For studies of LAT1 expression in ECs of LAT1^ECKD (i.e., tamoxifen-treated LAT1^fl/fl; Cdh5-Cre⁺) and littermate control (“WT”) LAT1^fl/fl; Cdh5-Cre⁻ mice, the isolated CD41⁻CD45⁻CD31⁺ MLECs were lysed in RIPA lysis buffer (Santa Cruz Biotechnology, Cat. sc-24948) with freshly added protease inhibitor and phosphate. The samples were kept on ice for 30 minutes, then beads were pulled down and removed by DynaMag magnet. The lysate was further disrupted by hydrodynamic shearing (21-gauge needle) followed by centrifugation at 10,000 × g for 10 minutes at 4°C. The supernatant was transferred into a fresh tube. The lysate protein concentrations were determined using the Pierce BCA protein assay kit (ThermoScientific, Cat. 23227). Samples were diluted with 4X Laemmli sample buffer (Bio-Rad, Cat. 1610747) and denatured at 65°C for 10 minutes. Approximately 30 μg protein extract was loaded onto precast 4 to 15% gradient SDS-PAGE gels (Bio-Rad, Cat. 4568084). Gel proteins were blotted onto a PVDF membrane (Bio-Rad, Cat. 1620174) for 1 hour with 100 V using a Bio-Rad immunoblot apparatus. The membranes were blocked with 5% nonfat milk in 1x TBST for 1 hour at room temperature, then incubated in anti-LAT1 (D-10), a mouse monoclonal antibody (Santa Cruz Biotechnology, Cat. sc-374232) diluted in blocking solution overnight at 4°C on a shaker. Next, membranes were incubated in mouse IgGκ light chain binding protein (m-IgGκ BP) conjugated to horseradish peroxidase (Santa Cruz Biotechnology, Cat. sc-516102) for 1 hour at room temperature. The immunoreactivity was detected using Amersham ECL Prime reagents (Cytiva, Cat. RPN2232) and quantified using a Bio-Rad ChemiDoc MP detection system and Image J (National Institutes of Health) analysis software. All LAT1 protein densitometry signals were normalized to the respective values for actin (MilliporeSigma, anti-actin, monoclonal antibody, Cat. MAB1501R) as a loading control.

Immunofluorescence Staining

Mice were anesthetized with ketamine/xylazine (100 and 10 mg/kg, respectively, i.p.). The lungs were perfused with PBS and inflated with 4% paraformaldehyde, and harvested (mice were therefore euthanized by bilateral thoracotomy). The lungs were immersed in fixative for 2 to 4 hours, then switched to PBS at 4°C overnight. The brains were removed and post-fixed overnight in 4% paraformaldehyde at 4°C. Next, lungs and brains were cryoprotected in 30% sucrose solution at 4°C for 1 day and embedded in Optimum Cutting Temperature (Sakura Finetek, Tissue-Tek O.C.T. Compound, Cat. 4583). After tissues were sectioned (lung sections 7 µM thick; brains 10 µM thick), the slides were allowed to air-dry, placed in PBS to wash out O.C.T., then permeabilized with 0.3% Triton X-100 in PBS for 30 minutes at room temperature. Endogenous biotin was blocked by incubating the slides with reagents A and B of the Endogenous Biotin Blocking Kit (Thermo Fisher, E-21390) for 15 to 30 minutes each. Each incubation was followed by three washes, consisting of submerging slides for 5 minutes in PBS. Sections were incubated with 5% normal goat serum in 0.3% Triton X-100 in PBS to prevent the nonspecific binding of the secondary antibodies for 1 hour at room temperature. Then, tissue sections were incubated with the unconjugated primary antibodies antiLAT1 pAb (Cosmo Bio United States, Cat. KAL-KE026, 100 µg/mL, 1:100 dilution) and purified rat anti-mouse CD31 (BD Pharmingen, 15.625 µg/mL, 1:50 dilution) in PBS containing 0.1% Triton X-100, 5% normal goat serum overnight at 4°C. Next, the sections were washed three times with PBS, and incubated for 1 hour at room temperature with goat anti-rabbit IgG (H + L) secondary antibody, biotin (Thermo Fisher, Cat. A16100, 1:500 dilution) and goat anti-rat IgG (H + L) highly cross-adsorbed secondary antibody, Alexa Fluor Plus 488 (Thermo Fisher, Cat. A48262, 1:400 dilution) in PBS. After washing the slides, LAT1 was detected by incubating tissue sections at room temperature for 30 minutes with streptavidin, Alexa Fluor 594 conjugate (Thermo Fisher, Cat. S32356), diluted 1:200 in PBS. Nuclei were counterstained with DAPI (Thermo Fisher, Cat. 62248). FluorSave Reagent (MilliporeSigma, Cat. 345789) was used as the mounting medium. Immunofluorescence images were captured using a Zeiss 780 upright confocal microscope with 63x oil-immersion objective for lung sections and a Zeiss 780 inverted confocal microscope with 20x objective for brain sections. Where indicated ([Supplementary Fig. S1], available in the online version), the lung sections were prepared and stained as described above but without signal amplification (i.e., not using the (strept) avidin–biotin complex [ABC] method). These immunofluorescence images were captured using a Zeiss 780 upright microscope with 20x objective.

SNO Uptake by MLECs

MLECs were isolated as above from tamoxifen-induced LAT1^ECKD (i.e., tamoxifen-treated LAT1^fl/fl; Cdh5-Cre⁺) and littermate LAT1^fl/fl; Cdh5-Cre⁻ (“WT,” also tamoxifen-exposed) control mice. The isolated CD41⁻CD45⁻CD31⁺ MLECs were then incubated with L-CSNO 250 µM for 30 minutes, washed three times using PBS, lysed, and frozen for later SNO assay. After thawing, cell lysates were incubated 1:1 in either PBS alone or in PBS containing HgCl₂, 0.6 mM for 10 minutes, then injected into a photolysis-chemiluminescence apparatus for SNO quantitation as described.[5] Results were normalized to the cell lysate protein concentration measured using a Pierce BCA protein assay kit (Thermo Scientific, Cat. 23227).

Determination of S-nitrosothiol Intracellular Accumulation by Flow Cytometry

Total (unfractionated) mouse lung cells were obtained as described above. Briefly, microdissected tissue was minced, digested with collagenase A/DNase, labeled with antibodies (CD31) specific for ECs (BD Biosciences, APC Rat Anti-Mouse CD31, Cat. 551262), CD45 (BD Biosciences, PE Rat Anti-Mouse CD45, Cat. 553081), and CD41(BD Biosciences, PE Rat Anti-Mouse CD41, Cat. 558040). The immunostained cells were loaded with DAF-FM diacetate (4-amino-5-methylamino-2',7'-difluorofluorescein [DAF-FM]), ThermoFisher Scientific, Cat. D23844) for 30 minutes, and rinsed by incubating in PBS three times. DAF-FM diacetate undergoes de-esterification by cellular esterases to form DAF-FM, impermeant to cell membranes, which reacts with NO derivatives to yield a fluorescence product. Cells were then incubated in the presence of CSNO at the indicated concentrations for up to 30 minutes (unless otherwise noted in time course data), followed by three washes, then analyzed by flow cytometry (Cytek Aurora). Controls included unstained cells, and single-color positive controls for each antibody, live/dead cells marker (Zombie Aqua, BioLegend, Cat. 423101), and DAF-FM diacetate to set gates and compensation. Mean fluorescence values of DAF-FM diacetate from CD31-positive population were normalized to the mean maximum fluorescence after subtracting background fluorescence in buffer-only control samples.

RBC Transfusion in Mice

Mice were anesthetized using ketamine/xylazine (100 and 10 mg/kg, respectively, i.p.), cannulated by tracheostomy, and warmed. We used continuous pulse oximetry (MouseOx) to measure arterial Hb O₂ saturation using a noninvasive probe placed on the shaved thigh. For RBC transfusions, PKH26-labeled RBCs (10 μL/g body weight, 35% Hct) from syngeneic/strain-control C57BL/6J mice) suspended in PBS were gradually warmed to 37°C, then infused i.v. (intravenously) over 10 seconds via a PE-10 tail-vein catheter. This hematocrit and other procedural details were selected to match those in prior studies.[4] [5] Ten minutes after the transfusion, the mouse lungs were harvested under anesthesia, perfused with PBS and inflated with 10% phosphate-buffered formalin, immersed in fixative for 2 to 4 hours, and then transferred to PBS (the mice were thus euthanized by bilateral thoracotomy). The lung frozen sections were prepared as described above. The lung ECs were identified using CD31 and nuclei by DAPI as described. Fluorescence microscopy was performed using a Keyence BZ-X800 microscope with 20x objective. Maximum intensity projections of the z-stacks are displayed in [Fig. 6].

Statistical Analysis

Data are expressed as individual values and the mean ± standard deviation or standard error of the mean except where otherwise noted. Statistical analyses were conducted using GraphPad Prism 9 software. Unpaired t-tests and ANOVA (1- or 2-way) were used. p <0.05 was considered statistically significant except where otherwise noted.

Results

Generation of Floxed LAT1 Mice

To generate a floxed LAT1 allele appropriate for Cre-mediated conditional inactivation of the LAT1 gene, a targeting vector was designed and constructed. Using BAC recombineering,[27] we inserted two loxP sites through homologous recombination flanking exon 3 of the LAT1 gene in G4 mouse ES cells[28] (schematized concisely in [Fig. 1] and in more detail in [Supplementary Fig. S2] [available in the online version]). The correct genomic targeting of the LAT1 floxed construct was obtained and characterized in two representative clones by long-range PCR (not shown) and Southern blot (not shown). Correctly targeted ES clones containing the LAT1^fl-neo allele were microinjected into ICR blastocysts to generate heterozygous LAT1^fl-neo mice. LAT1^fl-neo mice were crossed with FLPeR mice to remove the FRT-flanked neo cassette in their pups with a LAT1^fl/+/FLPeR⁺ genotype (data not shown). LAT1^fl/+/FLPeR⁺ mice were then backcrossed with C57BL/6J mice to generate LAT1^fl/+ mice that were devoid of both the neo cassette and FLPeR. PCR analyses with the appropriate primers ([Table 1]) distinguished mice bearing the LAT1^fl-neo, LAT1^fl, and/or LAT1^del allele, the last of which was obtained by Cre-mediated deletion of exon 3. Using primer pair number 3, no PCR product was amplified from the wild type (WT; “ + ”) allele because of the lack of sequences of primer 3R. Primers 4F and 4R were used to differentiate heterozygous floxed LAT1 mice (LAT1^fl/+) from homozygous floxed LAT1 mice (LAT1^fl/fl; not shown). Survival, absence of overt anatomic or functional abnormalities, and Mendelian inheritance of the LAT1^fl allele are indications of normal gene expression from the LAT1 allele with loxP-flanked exon 3 in unstressed mice.

Genetic Characterization of an Inducible, Endothelial Cell-Specific LAT1-Knockout Mouse

Since global knockout of LAT1 in mice has been found to be embryonically lethal,[29] we generated and characterized a novel EC-specific and time-specific inducible LAT1 knockdown mouse model (LAT1^fl/fl; Cdh5-Cre⁺) using a Cre/loxP system. LAT1^fl/fl mice were crossed with transgenic Cdh5 (PAC)-CreERT2 mice (referred to as Cdh5-Cre) carrying the Cre recombinase gene driven by the vascular endothelial cadherin Cdh5 promoter. The LAT1^fl allele was converted to a LAT1-null allele (LAT1^del) in a tamoxifen-inducible manner in adult mice by EC-specific Cre-mediated excision of exon 3 ([Fig. 2]). LAT1^fl/fl; Cdh5-Cre⁺ mice survived at a rate similar to that of control LAT1^fl/fl; Cdh5-Cre⁻ mice for up to 10 weeks following the last day of tamoxifen treatment (data not shown).

Fig. 2 Genotyping in LAT1^fl/fl;Cdh5-Cre mice. Mouse tail genomic DNA was genotyped for endothelial cell-specific Cdh5-Cre (upper), the LoxP-flanked LAT1 sites (middle), and the LAT1 deletion (lower). Results in the same mice (all littermates) genotyped pre- and post-Cre induction using tamoxifen are indicated. n = 4 LAT1^fl/fl; Cdh5-Cre⁺ mice and n = 6 LAT1^fl/fl; Cdh5-Cre⁻ mice were genotyped. In mice bearing Cdh5-Cre (but not those without), floxed LAT1 was deleted after tamoxifen administration, as determined by PCR. Labels indicate the positions of the expected PCR products, including β-actin and wild-type (wt) controls. PCR, polymerase chain reaction.

LAT1 mRNA and Protein Expression in MLECs of LAT1^ECKD Mice

EC-specific Cre-mediated deletion efficiency was determined by quantitative PCR (qPCR). LAT1 mRNA expression was significantly reduced (by 95%) in ECs isolated as illustrated ([Fig. 3B]) from lungs of LAT1^fl/fl; Cdh5-Cre⁺ mice in comparison with LAT1^fl/fl; Cdh5-Cre⁻ mice littermates after tamoxifen treatment of both groups. Compared to LAT1^fl/fl; Cdh5-Cre⁻ mice (n = 6), the level of LAT1 message was diminished in LAT1^fl/fl; Cdh5-Cre⁺ (n = 4) by 95%. We therefore refer to these mice henceforth as LAT1^ECKD mice, and to their tamoxifen-treated, Cre- littermates as “WT” mice.

Fig. 3 Endothelial cell (EC)-specific LAT1 knockdown as determined by qPCR and Western blots. (A) Tamoxifen dosing and lung harvest schedule, and lung EC isolation strategy based on positive selection for CD31 and the exclusion of CD45+ and CD41+ cells. (B) q-PCR results. LAT1 transcript was significantly decreased in the lung ECs of LAT^fl/fl; Cdh5-Cre+ (“LAT1^ECKD”) versus LAT^fl/fl; Cdh5-Cre⁻ (“WT”) lung ECs. LAT1 mRNA expression was normalized to respective beta-actin. n = 6 LAT1^fl/fl;Cdh5-Cre- and n = 4 LAT^fl/fl; Cdh5-Cre+ mice were studied. n = 5 males (M) and n = 5 females (F). (C) Typical Western blot image showing LAT1 knockdown at the protein level in tamoxifen-induced LAT1^ECKD (LAT^f/f; Cdh5-Cre + ) mice (relative to Cre- littermates). (D) Modest but significant decrease in LAT1 protein by densitometry (normalized to beta-actin). ****p = 0.0006 by unpaired t-test; *p < 0.05 by unpaired t-test. See also [Supplementary Fig. S3] (available in the online version). EC, endothelial cell; qPCR, qualitative polymerase chain reaction.

Compared to control WT mice, endothelial LAT1 protein abundance in LAT1^fl/fl; Cdh5-Cre⁺ mice was significantly diminished after Cre induction using tamoxifen ([Fig. 3C]).

CSNO Uptake by MLECs from LAT1^ECKD Mice Assayed Using Mercury-Coupled Photolysis-chemiluminescence

We isolated ECs from mouse lungs from LAT1^ECKD (tamoxifen-treated LAT1^fl/fl; Cdh5-Cre⁺) and littermate LAT1^fl/fl; Cdh5-Cre⁻ (also tamoxifen-exposed) control mice. MLECs were incubated with CSNO 250 µM for 30 minutes, followed by cell washing with PBS to remove residual extracellular CSNO. Cells were then lysed and treated with either HgCl₂ in PBS (inorganic mercury cleaves SNO from protein thiols, eliminating the SNO signal), or PBS alone (Con). SNO concentration (normalized to cellular protein concentration) was significantly depressed in LAT1^fl/fl; Cdh5-Cre⁺ mice as compared to that in LAT1^fl/fl; Cdh5-Cre⁻ littermates ([Fig. 4A]). SNO signal in the final wash buffer was minimal (not shown). Cell lysate SNO values were calculated by extrapolation against standard curves generated daily using S-nitrosoglutathione (GSNO). This technique is highly sensitive for SNO quantification, with a limit of detection under 10 nM (1 picomole) in these experiments.

Fig. 4 Depressed CSNO uptake after EC-specific LAT1 deletion. (A) SNO levels measured by mercury-coupled photolysis-chemiluminescence (MPC) assay in WT or LAT1^ECKD MLECs isolated as described for Fig. 3 and loaded (or not) with CSNO, 250 µM. **p < 0.01 (n = 8 WT and n = 10 LAT1^ECKD mice were studied; n = 13 females and n = 5 males). (B) Gating strategy for endothelial cells (MLECs) obtained from adult mouse lungs. After excluding debris (B, top left), doublets (B, top right), and dead cells (B, bottom left), CD45⁻/CD41⁻ and CD31⁺ MLECs (B, bottom right) were further assessed (relative mean fluorescence intensity). The immunostained lung cells were loaded with the SNO probe DAF-FM diacetate. Fluorescence was monitored after addition of varying [CSNO], as a function of either time (C; n = 1 each shown) or EC depletion of LAT1 (D; n = 5 per group; n = 8 F and n = 2 M). ^# p < 0.057 for 2-way ANOVA; *, p < 0.05 for unpaired t-test (t-testing was performed only at the highest [CSNO]). Horizontal bars: mean. Error bars: standard error of the mean. MLEC, mouse lung endothelial cell.

CSNO Uptake Is Depressed in MLECs from LAT1^ECKD Mice Assayed Using Flow Cytometry and DAF-FM

We then investigated the phenotypes present in MLECs from these mice. LAT1^ECKD (tamoxifen-treated LAT1^fl/fl; Cdh5-Cre⁺) and littermate LAT1^fl/fl; Cdh5-Cre⁻ (also tamoxifen-exposed) control mice were sacrificed and lungs were harvested. Lung cells were isolated and dispersed by collagenase; stained with CD31, CD41, and CD45; then loaded with the (S)NO probe DAF-FM diacetate. Cells were exposed to a range of CSNO concentrations. We gated ([Fig. 4B]) on the EC surface marker CD31 consistent with ECs, and tagged and gated out CD41+ and CD45+ cells in order to ignore any nonendothelial CD31+ cells (such as leukocytes and platelets). Exposing mouse lung cells to CSNO resulted in time and concentration-dependent ([Fig. 4C]) increases in DAF-FM fluorescence signal, consistent with intracellular SNO accumulation, as monitored by flow cytometry. The accumulation of SNO signal after CSNO exposure was modestly but significantly attenuated in cells from LAT1^ECKD mice ([Fig. 4D]). The results ([Fig. 4D]) indicate impaired CSNO uptake in ECs of the LAT1^ECKD mouse.

Detection of Endothelial LAT1 in the Lungs of LAT^ECKD Mice

LAT-1 was detected in whole lung by immunohistochemistry, and co-staining with the EC surface marker CD31 indicated its endothelial location (among other locations; [Fig. 5], left panels), consistent with our prior findings.[30] Little or no staining was seen in sections incubated with isotype-matched control antibody (not shown). LAT1 was detected in both the alveolar capillary endothelium ([Fig. 5]) and in the ECs of larger vessels in mouse lungs ([Supplementary Fig. S4], available in the online version). In lungs co-stained for LAT1 and the endothelial cell marker CD31, we did not see consistent differences between tamoxifen-treated LAT1^fl/fl; Cdh5-Cre⁺ and littermate LAT1^fl/fl; Cdh5-Cre⁻ mice in the endothelial abundance of LAT1 in alveolar capillaries using the ABC staining amplification method ([Fig. 5], left panels; [Supplementary Fig. S4], available in the online version). Similar findings and lack of apparent EC LAT1 knockdown in the lung were also seen using standard IHC (non-ABC method; [Supplementary Fig. S1], available in the online version). By contrast, in small vessels of the brain (cerebral cortex), endothelial LAT1 staining was obviously diminished in tamoxifen-treated LAT1^fl/fl; Cdh5-Cre⁺ (LAT1^ECKD) mice as compared with LAT1^fl/fl; Cdh5-Cre⁻ (WT) littermates also treated with tamoxifen ([Fig. 5], right; [Supplementary Fig. S5], available in the online version).

Fig. 5 LAT1 distribution in the lung and brain of LAT1^ECKD and WT mice. Immunofluorescence using the biotin-streptavidin amplification (ABC method) method was performed for LAT1 (red) and CD31 (green, endothelial cells) to determine the localization of LAT1 expression within the lung and brain using confocal microscopy (Zeiss). Images indicate that the colocalization of LAT1 and CD31 (yellow; consistent with LAT1 in ECs of both capillaries and larger vessels) did not differ consistently between WT and LAT1 ^ECKD mice in the lung (left), but was widely suppressed in the brain (right) of LAT1^ECKD mice. LAT1 is also visible in other cell types in the lung, including airway epithelial cells and macrophages. The results are typical of lungs and brains (see also [Supplementary Fig. S4] (available in the online version) (lung, n = 3 LAT1^ECKD and n = 3 WT by ABC method), [Supplementary Fig. S5] (available in the online version) (brain, n = 3 LAT1^ECKD and n = 3 WT), and [Supplementary Fig. S1] (available in the online version) (lung, n = 3 LAT1^ECKD and n = 3 WT, non-avidin-biotin complex method) from several mice treated with tamoxifen daily for five days as described. Blue: DAPI. Maximum intensity projection of a Z-stack after IHC. Scale bar = 20 μm.

Transfusion of Mouse RBCs in Mice with EC-Specific LAT1 Depletion

We had previously demonstrated that the ability of transfused RBCs to resist adhesion to microvascular lung ECs is RBC LAT1-dependent (sensitive to a LAT1 inhibitor applied to the RBC transfusates) and appears to involve SNO export by RBCs.[2] In order to test the role of SNO import by EC LAT1 in the modulation of responses to RBC transfusion, we performed preliminary experiments in LAT1^ECKD mice. Mice were anesthetized, cannulated by tracheostomy, allowed to breathe spontaneously, and kept warm with a warming pad. Continuous pulse oximetry measured arterial blood Hb O₂ saturation (SpO₂). For RBC transfusions, 10 μL/g body weight of PKH26-labeled RBCs (from syngeneic/strain-control C57BL/6J mice) suspended in PBS at 35% Hct, warmed to 37°C, was infused i.v. (intravenously) over 10 seconds via a tail-vein catheter. SpO₂ decreased significantly after transfusion in tamoxifen-treated LAT1^fl/fl; Cdh5-Cre⁺ (LAT1^ECKD) mice but not in littermate tamoxifen-treated LAT1^fl/fl; Cdh5-Cre⁻ (“WT”) mice or tamoxifen-untreated LAT1^fl/fl; Cdh5-Cre⁺ mice ([Fig. 6A, B]; p < 0.05 for LAT1^ECKD vs. each control group). Fluorescence histology was performed postmortem in mouse lungs perfused free of blood to track the transfused (labeled) RBCs (the images in [Fig. 6C, D] are typical of n = 3 such experimental pairs). Posttransfusion RBC sequestration in the lungs was greater in LAT1^fl/fl; Cdh5-Cre⁺ mice than in LAT1^fl/fl; Cdh5-Cre⁻ controls. Together, these findings are consistent with a role for SNO import via EC LAT1 in preventing the adhesion of transfused RBCs. Notably, baseline SpO₂ in the LAT1^fl/fl; Cdh5-Cre⁺ mice was normal and there was no evidence of excessive basal intrapulmonary RBC adhesion, suggesting that when EC LAT1 is absent, compensatory mechanisms may arise in the erythrocyte and its precursors.

Fig. 6 RBC sequestration and blood oxygenation changes after transfusion are LAT1-sensitive. WT (wild-type, either Cre-, vehicle-treated; (n = 2) or Cre-, tamoxifen (Tam)-treated (n = 6)) or LAT1^ECKD (Cre + , Tam-treated (n = 6) mice were transfused with fresh, PKH(red)-labeled syngeneic (C57BL/6J) mouse RBCs. Typical 12-minute recordings of blood Hb O₂ saturation (SO₂) in mice (A), mean and individual peak SO₂ changes (B), and fluorescence lung images (C, D) are shown. Images are typical of n = 3 paired experiments. Red: PKH (transfused RBCs); green: CD31; blue: DAPI. *p < 0.05 by one-way ANOVA. n = 9 F and n = 5 M mice were used in (B).

Discussion

We engineered and characterized an inducible, EC-specific LAT1 knockout mouse model in order to investigate the role of EC LAT1 in the uptake (import) of antiadhesive SNOs and in the modulation of respiratory sequelae, such as RBC sequestration and impaired blood oxygenation, after RBC transfusion in transfused mice. Tamoxifen-induced partial LAT1 protein knockdown was confirmed and LAT1 mRNA was nearly absent from lung ECs under these conditions. CSNO uptake by MLECs from such mice, determined by two independent methods, was significantly impaired ex vivo. In LAT1^ECKD mice (but not in uninduced control littermate mice) in vivo, RBC transfusion elicited decreases in blood oxygenation and increased sequestration of transfused RBCs in the lungs, consistent with (but not definitive for) RBC adhesion to ECs within the lung. Taken together, these findings confirm the successful conditional endothelial knockdown of LAT1 and are consistent with a role for LAT1-mediated SNO import by ECs in modulating RBC adhesivity.

This is, to our knowledge, the first report of a murine genetic model enabling the investigation of the intercellular movement of SNOs. The biological effects of endogenously produced or therapeutically administered nitric oxide (NO) take place in many instances through the intermediacy of SNOs.[17] [31] [32] In contrast to NO itself, SNOs are capable of resisting intravascular elimination, which has implicated them in numerous paracrine and endocrine cellular activities that NO itself cannot achieve.[33] But despite the recognition that SNOs subserve intercellular signaling, no genetic tool or model allowing the study of intercellular SNO transport has been reported to date. By contrast, pharmacological approaches using known inhibitors of LAT have suggested a role for this transporter family in the cellular import of SNOs by ECs, smooth muscle cells, and others.[11] [23] [24] [34] [35] LATs typically function as antiporters, meaning that the well-studied inward transport of substrate AAs is balanced by the (less studied) outward transport of other AAs by the same transporter. Accordingly, we previously demonstrated that the export of CSNO by RBCs can be inhibited by the LAT1-specific inhibitor JPH203.[5] However, because pharmacological probes can act nonspecifically, and particularly given the substantial overlap among substrates of the multiple cell membrane AA transporters, the new ability to study their SNO-transport function with greater specificity using genetic techniques represents an important advance. Here we show that in LAT1^ECKD mice, transfused RBCs were sequestered in pulmonary capillaries and other vessels, mirroring the proadhesive effect we reported previously when treating RBCs or ECs with LAT1 inhibitors in cellular adhesion assays, and the proadhesive effect of treating RBC transfusates with LAT1 inhibitors prior to transfusing them in vivo.[5] In that study, the increased adhesivity could be surmounted by the administration of exogenous L-CSNO (but not D-CSNO),[5] which is mechanistically consistent with stereospecific LAT1-mediated SNO export from RBCs acting at baseline to oppose RBC–endothelial adhesion. The present study was not designed to determine whether the EC adhesion of native RBCs is augmented after EC LAT1 knockdown. This can be tested in future studies, as can the question of whether ECs recruit compensatory antiadhesive pathways when the import of antiadhesive SNO is depressed.

Using a tamoxifen-inducible, EC-specific gene deletion approach, we demonstrated marked decreases in LAT1 transcripts by RT-qPCR, together with modest, but statistically significant, decreases in LAT1 protein abundance in lung ECs by western blot with densitometry. It is possible that the cell isolation procedure (for western analysis of protein) underestimates the degree of EC-specific knockdown since the purity of the assayed cell (EC) population is less than 100%. Alternatively, it is possible that, under the conditions used, membrane-resident LAT1 was unexpectedly very stable following this particular duration of Cre induction exposure. The persistence of over half of the LAT1 protein is likely to have played a role in the effects of LAT1 depletion on CSNO uptake by MLECs, which was also incompletely decreased. In future experiments, the tamoxifen induction regimen (dose and duration) and subsequent “washout (protein turnover)” period can and should be increased or otherwise modified in attempts to examine the effects of more complete LAT1 protein knockdown. Given the substantial overlap in function among the multiple AA transporters, it is possible that compensatory upregulation of the expression of the closely related LAT2 (for example) took place in these mice. But any such compensatorily increased expression of LAT2 or other LATs apparently did not overcome the phenotypic effects of the LAT1 knockdown at the cellular and organismal levels.

The reason for the absence of any apparent reduction in visual LAT1 signal in endothelial locations of lungs of the LAT1^ECKD mouse is uncertain. The absence of this finding may reflect relatively low baseline expression of LAT1 in the lung, the low basal turnover of lung ECs, optical spillover of LAT1 signal into ECs from adjacent alveolar epithelial and smooth muscle cells, and/or relative nonspecificity of the antibody. Future investigation is needed to test these possibilities. In contrast to the failure to demonstrate LAT1 knockdown visually in ECs in the lung, however, we demonstrated near-knockout of LAT1 message, substantial knockdown (32%, p < 0.05) of LAT1 protein in MLECs, and LAT1-dependent phenotypes at the cellular (SNO uptake) and in vivo (blood oxygenation and RBC sequestration after RBC transfusion) levels. The fact that LAT1 signal in brain vessels was substantially diminished in the LAT1^ECKD mouse indicates that endothelial knockdown of LAT1 did take place, but that its detection may be sensitive to organ-specific technical and other considerations.

In response to certain stimuli, RBCs export low-molecular-weight SNOs such as CSNO, which in turn promote vasodilation in hypoxic tissues and limit the adhesivity of RBCs to ECs.[1] [5] The vasoregulatory activities of RBC-derived SNOs are impaired under some circumstances, for example during conventional blood (RBC) banking.[3] [4] After the transfusion of banked RBCs, these lesions may contribute to impaired O₂ uptake by the lung[5] and O₂ delivery to tissues,[36] and to organ dysfunction and other disappointing outcomes in the transfused recipient.[2] [37] In order to test the in vivo significance and the LAT1 dependence of CSNO uptake by ECs, we performed RBC transfusions in LAT1^ECKD and control transgenic mice. The knockdown of LAT1 led to excess RBC sequestration (consistent with but not dispositive for endothelial adhesion) in the lung and impaired O₂ uptake, consistent with our finding of the loss of antiadhesive[5] SNO import by lung ECs and mirroring the proadhesive effects of transfusing RBCs treated with LAT1 inhibitors, which depressed SNO export.[5] The precise microanatomic distribution of RBCs sequestered in the lung following their transfusion in LAT1^ECKD mice is uncertain. PKH label, indicating the transfused RBCs (or fragments of these cells), appeared in alveolar septal spaces consistent with a pulmonary capillary endothelial localization, and was also visible in larger vessels, appearing in some cases as RBC aggregates ([Fig. 6]). Intra-alveolar PKH label was visible infrequently, consistent with infrequent RBC extravasation into the airspaces.

Precisely how LAT1-imported SNO transport could prevent endothelial adhesivity is unknown, and may involve antioxidant effects or regulatory S-nitrosylation of relevant protein targets. RBC–EC adhesion was not definitively demonstrated and we therefore refer to the posttransfused RBCs as sequestered in the lung (rather than adherent to ECs). But the endothelial location of the knockdown of LAT1 (shown in ECs from the lung and in the brain), together with the fact that extra-endothelial movement and actions of transfused RBCs are unlikely to take place without stable endothelial contact at some point, makes it most likely that the endothelium is central to the LAT1-dependent oxygenation and RBC sequestration phenotypes that we observed. We speculate that the pathological link between EC SNO import and depressed blood oxygenation may involve increases in endothelial permeability leading to acute lung injury, or ventilation–perfusion mismatching owing to RBC adhesion to ECs, or other mechanisms.

Tărlungeanu and coworkers reported the production of a mouse with LAT1 deletion using mice resulting from cross-breeding LAT1^fl/fl and Tie2-Cre (i.e., also EC-targeted) mice in order to investigate the role of LAT1 at the blood–brain barrier, deficiency of which may in turn play a role in autism spectrum disorders.[21] (The successful production of their LAT1^ECKD and the underlying LAT1-floxed mouse[29] were reported after we had initiated ours). We opted to use the Cdh5-Cre^ERT2 as our endothelial Cre in mice instead, because there is minimal off-target recombinase activity (for example, affecting hematopoietic cells) when using the Cdh5-Cre, in contrast to the case when using a Tie2-Cre, which can also be expressed amply in hematopoietic cells.[26] [38] Given our focus on blood–EC interactions, this greater EC-specificity was critical.

Conclusion

We applied Cre-lox technology and used a tamoxifen-sensitive ER^T2-driven Cre expression system targeting ECs to produce an inducible, EC-specific LAT1 knockout mouse model. This allowed the knockdown of LAT1 expression in ECs in a temporally controlled and focal manner. Our results indicate that the ability of MLECs to import SNO ex vivo is LAT1-dependent, and suggest that the ability of transfused RBCs to resist intrapulmonary adhesion to ECs in vivo is dependent at least in part on LAT1 and the import of antiadhesive SNO. The LAT1-floxed mouse model, in combination with other cell-specific Cre recombinases, could serve as a research tool to investigate more broadly the movement of SNOs between cell types.

• References

• 1 McMahon TJ. Red blood cell deformability, vasoactive mediators, and adhesion. Front Physiol 2019; 10: 1417
• 2 Bennett-Guerrero E, Veldman TH, Doctor A. et al. Evolution of adverse changes in stored RBCs. Proc Natl Acad Sci U S A 2007; 104 (43) 17063-17068
• 3 Reynolds JD, Ahearn GS, Angelo M, Zhang J, Cobb F, Stamler JS. S-nitrosohemoglobin deficiency: a mechanism for loss of physiological activity in banked blood. Proc Natl Acad Sci U S A 2007; 104 (43) 17058-17062
• 4 Zhu H, Zennadi R, Xu BX. et al. Impaired adenosine-5′-triphosphate release from red blood cells promotes their adhesion to endothelial cells: a mechanism of hypoxemia after transfusion. Crit Care Med 2011; 39 (11) 2478-2486
• 5 Dosier LBM, Premkumar VJ, Zhu H, Akosman I, Wempe MF, McMahon TJ. Antagonists of the system L neutral amino acid transporter (LAT) promote endothelial adhesivity of human red blood cells. Thromb Haemost 2017; 117 (07) 1402-1411
• 6 Turgeman A, McRae HL, Cahill C, Blumberg N, Refaai MA. Impact of RBC transfusion on peripheral capillary oxygen saturation and partial pressure of arterial oxygen. Am J Clin Pathol 2021; 156 (01) 149-154
• 7 Reynolds JD, Bennett KM, Cina AJ. et al. S-nitrosylation therapy to improve oxygen delivery of banked blood. Proc Natl Acad Sci U S A 2013; 110 (28) 11529-11534
• 8 Vostal JG, Buehler PW, Gelderman MP. et al. Proceedings of the Food and Drug Administration's public workshop on new red blood cell product regulatory science 2016. Transfusion 2018; 58 (01) 255-266
• 9 Zhang R, Hess DT, Qian Z. et al. Hemoglobin βCys93 is essential for cardiovascular function and integrated response to hypoxia. Proc Natl Acad Sci U S A 2015; 112 (20) 6425-6430
• 10 Zhang R, Hess DT, Reynolds JD, Stamler JS. Hemoglobin S-nitrosylation plays an essential role in cardioprotection. J Clin Invest 2016; 126 (12) 4654-4658
• 11 Li S, Whorton AR. Functional characterization of two S-nitroso-L-cysteine transporters, which mediate movement of NO equivalents into vascular cells. Am J Physiol Cell Physiol 2007; 292 (04) C1263-C1271
• 12 Quan L, Ohgaki R, Hara S. et al. Amino acid transporter LAT1 in tumor-associated vascular endothelium promotes angiogenesis by regulating cell proliferation and VEGF-A-dependent mTORC1 activation. J Exp Clin Cancer Res 2020; 39 (01) 266
• 13 Najumudeen AK, Ceteci F, Fey SK. et al; CRUK Rosetta Grand Challenge Consortium. The amino acid transporter SLC7A5 is required for efficient growth of KRAS-mutant colorectal cancer. Nat Genet 2021; 53 (01) 16-26
• 14 Scalise M, Galluccio M, Console L, Pochini L, Indiveri C. The human SLC7A5 (LAT1): the intriguing histidine/large neutral amino acid transporter and its relevance to human health. Front Chem 2018; 6: 243
• 15 Sinclair LV, Rolf J, Emslie E, Shi YB, Taylor PM, Cantrell DA. Control of amino-acid transport by antigen receptors coordinates the metabolic reprogramming essential for T cell differentiation. Nat Immunol 2013; 14 (05) 500-508
• 16 Kubes P, Suzuki M, Granger DN. Nitric oxide: an endogenous modulator of leukocyte adhesion. Proc Natl Acad Sci U S A 1991; 88 (11) 4651-4655
• 17 Fox-Robichaud A, Payne D, Hasan SU. et al. Inhaled NO as a viable antiadhesive therapy for ischemia/reperfusion injury of distal microvascular beds. J Clin Invest 1998; 101 (11) 2497-2505
• 18 McMahon TJ, Shan S, Riccio DA. et al. Nitric oxide loading reduces sickle red cell adhesion and vaso-occlusion in vivo. Blood Adv 2019; 3 (17) 2586-2597
• 19 Boado RJ, Li JY, Nagaya M, Zhang C, Pardridge WM. Selective expression of the large neutral amino acid transporter at the blood-brain barrier. Proc Natl Acad Sci U S A 1999; 96 (21) 12079-12084
• 20 Asor E, Stempler S, Avital A, Klein E, Ruppin E, Ben-Shachar D. The role of branched chain amino acid and tryptophan metabolism in rat's behavioral diversity: Intertwined peripheral and brain effects. Eur Neuropsychopharmacol 2015; 25 (10) 1695-1705
• 21 Tărlungeanu DC, Deliu E, Dotter CP. et al. Impaired amino acid transport at the blood brain barrier is a cause of autism spectrum disorder. Cell 2016; 167 (06) 1481-1494.e18
• 22 Ohtsuki S, Yamaguchi H, Kang Y-S, Hori S, Terasaki T. Reduction of L-type amino acid transporter 1 mRNA expression in brain capillaries in a mouse model of Parkinson's disease. Biol Pharm Bull 2010; 33 (07) 1250-1252
• 23 Zhang Y, Hogg N. The mechanism of transmembrane S-nitrosothiol transport. Proc Natl Acad Sci U S A 2004; 101 (21) 7891-7896
• 24 Li S, Whorton AR. Identification of stereoselective transporters for S-nitroso-L-cysteine: role of LAT1 and LAT2 in biological activity of S-nitrosothiols. J Biol Chem 2005; 280 (20) 20102-20110
• 25 Gaston B, Smith L, Bosch J. et al. Voltage-gated potassium channel proteins and stereoselective S-nitroso-l-cysteine signaling. JCI Insight 2020; 5 (18) e134174
• 26 Sörensen I, Adams RH, Gossler A. DLL1-mediated Notch activation regulates endothelial identity in mouse fetal arteries. Blood 2009; 113 (22) 5680-5688
• 27 Liu P, Jenkins NA, Copeland NG. A highly efficient recombineering-based method for generating conditional knockout mutations. Genome Res 2003; 13 (03) 476-484
• 28 George SH, Gertsenstein M, Vintersten K. et al. Developmental and adult phenotyping directly from mutant embryonic stem cells. Proc Natl Acad Sci U S A 2007; 104 (11) 4455-4460
• 29 Poncet N, Mitchell FE, Ibrahim AF. et al. The catalytic subunit of the system L1 amino acid transporter (slc7a5) facilitates nutrient signalling in mouse skeletal muscle. PLoS One 2014; 9 (02) e89547
• 30 Bao EL, Chystsiakova A, Brahmajothi MV. et al. Bronchopulmonary dysplasia impairs L-type amino acid transporter-1 expression in human and baboon lung. Pediatr Pulmonol 2016; 51 (10) 1048-1056
• 31 Ibrahim YI, Ninnis JR, Hopper AO. et al. Inhaled nitric oxide therapy increases blood nitrite, nitrate, and s-nitrosohemoglobin concentrations in infants with pulmonary hypertension. J Pediatr 2012; 160 (02) 245-251
• 32 McMahon TJ, Doctor A. Extrapulmonary effects of inhaled nitric oxide: role of reversible S-nitrosylation of erythrocytic hemoglobin. Proc Am Thorac Soc 2006; 3 (02) 153-160
• 33 Liu T, Schroeder HJ, Wilson SM. et al. Local and systemic vasodilatory effects of low molecular weight S-nitrosothiols. Free Radic Biol Med 2016; 91: 215-223
• 34 Granillo OM, Brahmajothi MV, Li S. et al. Pulmonary alveolar epithelial uptake of S-nitrosothiols is regulated by L-type amino acid transporter. Am J Physiol Lung Cell Mol Physiol 2008; 295 (01) L38-L43
• 35 Broniowska KA, Zhang Y, Hogg N. Requirement of transmembrane transport for S-nitrosocysteine-dependent modification of intracellular thiols. J Biol Chem 2006; 281 (45) 33835-33841
• 36 Reynolds JD, Posina K, Zhu L. et al. Control of tissue oxygenation by S-nitrosohemoglobin in human subjects. Proc Natl Acad Sci U S A 2023; 120 (09) e2220769120
• 37 Tinmouth A, Fergusson D, Yee IC, Hébert PC. ABLE Investigators, Canadian Critical Care Trials Group. Clinical consequences of red cell storage in the critically ill. Transfusion 2006; 46 (11) 2014-2027
• 38 Payne S, De Val S, Neal A. Endothelial-specific cre mouse models. Arterioscler Thromb Vasc Biol 2018; 38 (11) 2550-2561