Keywords
breast cancer - biomarker - TNBC - microRNAs - diagnosis - chemotherapy
Introduction
Breast cancer remains leading form of cancer worldwide affecting large female population.
As per clinical data, nearly 2.3 million breast cancer cases were reported/diagnosed
in the year 2020 that leads to 0.7 million deaths. GLOBOCAN, 2020, estimated an alarming
number of cases where 7.8 million females alive by the end of year undergone for clinical
diagnosis in the last 5 years.[1] Triple-negative breast cancer (TNBC) continues to be the leading cause of cancer-related
death in Indian women. In women with fatty breast parenchyma and thick breasts, respectively,
conventional mammography screening sensitivity ranges from 98 to 36%.[2] Therefore, for the early diagnosis of breast cancer, the development of minimally
invasive diagnostic tools is necessary. At least four clinically significant molecular
subtypes of breast cancer are now recognized, including TNBC, human epidermal growth
factor receptor 2 (HER-2)-enriched, luminal A, and luminal B.[3] TNBC is a heterogeneous subset of these tumors that is positive for basal cytokeratin
⅚ or estimated glomerular filtration rate but does not express estrogen receptors,
progesterone receptors, or HER-2 gene amplification.[4] They are also very aggressive and typically affect young patients.[5]
Neoadjuvant chemotherapy may, in some cases, increase a patient's eligibility for
breast-conservation surgery with a decreased risk of local recurrence, but it may
also be associated with unfavorable patient outcomes, especially in those who do not
have a pathological complete response.[6]
[7] As a result, while a patient is receiving neoadjuvant chemotherapy, early identification
of individuals who are not responding well to treatment enables the treatment to be
changed effectively to address avoidable adverse effects of systemic therapy. Therefore,
it is necessary to create minimally invasive markers with high specificity and sensitivity
for tracking chemotherapy response as well as for spotting cancers that become resistant
to systemic therapy.[8] MicroRNAs (miRNAs) have been investigated as potential predictive and diagnostic
biomarkers in this regard in the past.[9]
[10] miRNAs are found in the extracellular space and as circulating molecules in bodily
fluids such blood, serum, plasma, urine, tears, saliva, seminal fluid, cerebrospinal
fluid, and extracellular fluid, among others.[11] miRNA dysregulation has a negative impact on the prognosis overall because it contributes
to the emergence of treatment resistance and all types of cancer.[12]
[13]
Because of this, evaluating miRNA can help with treatment responsiveness, extensive
surveillance of high-risk patients, and identifying patients with metastases. Identifying
circulating miRNAs as prognostic indicators in TNBC as a result of neo-adjuvant chemotherapy
is the aim of this study. This will be accomplished by comparing the expression of
different miRNAs in TNBC patients to that in healthy females. This study aims to understand
how chemotherapy exposure affects the expression of different miRNAs in breast cancer
cell lines both before and after treatment with particular anticancer drugs.[13]
[14] Despite the fact that numerous studies have demonstrated that miRNAs can be successfully
used for diagnostic and prognostic purposes in TNBC, there have not been many studies
in an Indian context that have concentrated on the specific miRNAs expressed in TNBC
in the Indian population, which can then be studied for specificity as a noninvasive
diagnostic marker. In this study, much emphasis was given on has-mir-125, has-mir-34a,
has-mir-200c, has-mir-221, and has-mir-21. Additionally, this study also aims to evaluate
in vitro expression of miRNAs on breast cancer cell lines and their correlation among
drug treatment. Overall, the goal of this study is to analyze the expression of miRNAs
and their response toward drugs.
Materials and Methods
Study Design
After scrutinizing 100 breast cancer patients, 25 samples (n = 25) of serum from patients with TNBC who had not yet received treatment and 25
serum samples from healthy, normal women were obtained from the All India Institute
of Medical Sciences (AIIMS), Bhopal, outpatient department (OPD). The patients were
chosen at random as they arrived at the hospital's Onco-surgery/Radiotherapy OPD.
Collected blood was centrifuged at 3,000 g for 15 minutes at 4°C after standing at
room temperature for at least 30 minutes. Isolated serum was then aliquoted (500 µL)
into 1.5 mL Eppendorf tubes and kept at 80°C until RNA extraction.
Cell Culture and Cell Growth Assay
The National Centre for Cell Science, Pune provided the human breast cancer cell lines
MDA-MB-231, which were cultured in Eagle's modified essential medium at 37°C with
5% CO2. In 96-well plates, MDA-MB-231 and MDA-MB-231/epirubicin, capecitabine, and paclitaxel
were plated. Cell viability was assessed at 0, 24, 48, and 72 hours using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl
tetrazolium bromide (MTT) reagent (Keygen Biotech, Nanjing, China). By measuring the
absorbance at 490 nm on enzyme-linked immunosorbent assay reader, cell viability was
determined (BioTek).
Colorimetric MTT (Tetrazolium) Assay
MTT was used to assess the impact of three anticancer drugs, namely epirubicin, capecitabine,
and paclitaxel, on the TNBC cell line MDA-MB-231. In 90 L of culture media, 5 103
MDA-MB-231 cells were seeded onto 96-well microtiter plates, and the plates were incubated
overnight. The three anticancer drugs were applied to the cells in varied quantities
for 24 hours. Each well received 10% v/v of the MTT solution, which was produced at
5 mg/mL in sterile phosphate buffered saline, and was then incubated at 37°C for 4 hours.
To fully solubilize the formazan crystals, dimethyl sulfoxide was added, and the micro-plate
reader was used to measure absorbance at 570 nm (BioTek). The number of reagents required
to block 50% of cellular proliferation following a 48-hour treatment period is known
as the half maximal inhibitory concentration (IC50). Epirubicin's IC50 was determined
to be 74 µM, capecitabine's IC50 to be 85 µM, and paclitaxel's IC50 to be 24µM.
Reverse Transcriptase PCR
The total RNA from breast cancer cell lines was extracted using Trizol method. Using
the miRNAs sequence (Assay Technology), distinct miRNA primers for each of the five
miRNAs were designed and synthesized, and then each miRNA's unique annealing temperature
was determined ([Table 1]). Using an avian myeloblastosis virus reverse transcriptase kit that is commercially
available from GCC Biotech, 500 ng of total RNA was reverse transcribed. The reaction
mixtures were then incubated at 16°C for 30 minutes, 42°C for 30 minutes, 85°C for
5 minutes, and then held at 4°C. Before usage, the produced cDNA was kept at -20°C.
Table 1
microRNA (miRNA) primer sequence
|
miRNA
|
Primer sequence
|
|
miR 34a-5p
|
5′-TGCGCTGGCAGTGTCTTAGCTG-3′
|
|
miR 221–5p
|
5′-GCACCTGGCATACAATGTAGA -3′
|
|
miR 125–5p
|
5′-TCCCTGAGACCCTAACTTG-3′
|
|
miR 200c-3p
|
5′-TAATACTGCCGGGTAATGATGGA-3′
|
|
miR-21–5p
|
5′-GCCCGCTAGCTTATCAGAC-3′
|
|
U6
|
5′- GCTTCGGCAGCACATATACTAAAAT -3′
|
Quantitative Real-Time PCR
Using the Sybr green matrix kit (Bio-Rad) and 20 ng cDNA per 20 µL reaction, real-time
polymerase chain reaction (PCR) was performed individually for sera and cell lines
with their respective normal controls. The real-time (RTPCR) cycles included 40 cycles
of 95°C for 1 minute. and 58°C for 1 minutes, followed by predenaturation at 1 cycle
of 95°C for 3 minutes. Every action, including the no-template controls, was performed
twice. Fixed threshold settings were used to obtain the resulting Cq values. To maintain
the same efficiency across all miRNA analyses, we have always employed the same concentration
of cDNA. Based on the threshold cycle (Ct) value, the twofold change in miRNA expression
for each breast tumor sample in comparison to the normal control was computed using
the following formula: relative quantification (RQ) = 2 − ΔΔCT. miRNA expression was standardized to serum volume because U6 and 5S rRNA are destroyed
in serum samples and there isn't a consensus housekeeping miRNA for the RT-quantitative
PCR investigation of serum miRNAs.
Statistical Analysis
All statistical analyses, pie charts, dot plots, and box-whisker plots were performed
using EZR (Easy R), R Commander version 2.7–1. Bar graphs were created using Microsoft
Excel 2019 software. Heat map graphics were produced using Graph Prism Version 9.
Using the Kolmogorov–Smirnov test for normal distribution, the normality of a continuous
variable was evaluated. Mann–Whitney U test without parameters. The statistics were
provided together with the median and interquartile range using the U test to determine
the statistical significance between the two groups (interquartile range [IQR]). Statistical
significance was defined as a p-value less than 0.05 (p = 0.05). To assess the predictive potential, receiver operating characteristic curve
analysis and area under the curve (AUC) calculation were used.
Results
Patient Demographics
Here in this study, 50 people in all were enrolled in the trial, of which 25 (the
test group) had TNBC and 25 (the control group) were otherwise healthy people. In
contrast to the healthy control group, which had a mean age of 41.68 years (standard
deviation [SD]: 14.25 years), the test group had a mean age of 50 years (SD: 11.72
years) ([Supplementary Fig. S1]). Here, 13 patients (52%) and 12 patients (48%) from the test group of this study's
participants were from rural areas, whereas all 25 of the healthy controls were from
metropolitan areas. Among the patients enrolled in the test group, 11 (44%) were premenopausal
women and 14 (56%) were postmenopausal women ([Supplementary Table S1]). [Supplementary Fig. S2] summarizes IC 50 values of anticancer drugs used in this study: a. Epirubicin, b;
paclitaxel and c; capecitabine. Seven (28%) of the 25 TNBC patients recruited in this
study had a confirmed family history of breast cancer, compared with 18 (72%) of the
patients who had no such history ([Supplementary Table S2]).
Risk Factors and Comorbidities
As the result showed in [Supplementary Table S3], three (12%) of the 25 TNBC patients participating in the trial disclosed a history
of cigarette use, but no one disclosed a history of alcohol use. Of the 24 TNBC patients,
24 (96%) disclosed a history of pregnancy. Further, 4 (16%), 13 (52%), and 8 (32%)
of the test group members had body mass indices (BMIs) of 18.5 to 22.9, 23 to 24.9,
and less than 25, respectively. Eight (32%) had diabetes mellitus, five (20%) had
hypertension, and two (8%) had hypothyroidism. Nine patients (36%) and 16 (64%) of
the patients, respectively, were found to have hemoglobin levels below 12 mg/dL. As
per data summarized in the [Supplementary Table S4], only 3 (12%) of the patients in the test group had lesions in their right breast,
compared with 22 (88%) who had involvement in their left breast. Eleven (44%) had
stage II, 3 (12%) had stage III, and 11 (44%) had stage IV, according to the American
Joint Committee on Cancer. There were 25 TNBC patients (100%) who were all involved
in the lymph nodes. Eight (32%) of the patients who were enrolled in the test group
experienced metastases, while 17 (68%) did not.
Expression Profile of miRNAs
Here in this study selection of miRNAs for their expression profile analysis associated
with the TNBC patients was performed. Previous studies have demonstrated role of mir-34a,[15] miR125,[16]
[17]
[18] miR-21,[19]
[20] miR221,[21] and mir-200[22]
[23]
[24] miRNAs in the development of TNBC. The miRNA mean cycle threshold (Ct) levels were
calculated independently for patients and controls ([Supplementary Table S5], [S6]). By deducting the Δ Ct values of the controls from the Ct values of the cases,
the Ct value was computed. miR125 had a Ct of 2.77, miR34a a Ct of -1.31, miR200c
a Ct of 0.71, miR21 a Ct of 1.61, and miR221 a Ct of -0.88 ([Tables 2], [3]). The difference between cases and samples for miR125 (median: 36.62, IQR: 3.365)
and miR21 (median: 36.285, IQR: 2.7225) was found to be statistically significant
(p< 0.0001 and p< 0.005, respectively). For miR34a, miR200c, and miR221, the difference between cases
and samples was found to be not statistically significant ([Table 4]).
Table 2
Circulating miRNAs differentially expressed in the plasma of TNBC cases compared with
healthy controls in PCR analysis
|
miRNA
|
Mean Ct
(Control)
|
Mean Ct
(Cases)
|
Δ Ct
|
|
miRNA 125
|
39.7024
|
36.9388
|
2.77
|
|
miRNA 34a
|
37.28
|
38.598
|
−1.31
|
|
miRNA 200c
|
13.1792
|
13.8828
|
−0.71
|
|
miRNA 21
|
35.5008
|
37.1144
|
−1.61
|
|
miRNA 221
|
28.1516
|
29.0376
|
−0.88
|
Abbreviations: Ct, cycle threshold; miRNA, microRNA; PCR, polymerase chain reaction.
p-Value <0.05.
Table 3
Mann–Whitney U test: Statistical identification of microRNA (miRNA) that was differentially
expressed between cases and controls in the set
|
miRNA
|
Median
|
Interquartile range (IQR)
|
p-Value
|
|
miRNA 125
|
38.62
|
3.365
|
<0.0001****
|
|
miRNA 34a
|
39.315
|
2.945
|
0.764
|
|
miRNA 200c
|
30.06
|
1.49
|
0.159
|
|
miRNA 21
|
36.285
|
2.7225
|
<0.05*
|
|
miRNA 221
|
27.565
|
1.8375
|
0.0859
|
p-Value <0.05.
Table 4
miRNA expression before and after treatment with anticancer agents in MDA-MB-231 cell
line (Ct values)
|
U6
|
mir200c
|
mir21
|
mir221
|
mir34a
|
mir125
|
|
Control
|
18.53
|
28.3
|
31.6
|
22.7
|
11.5
|
28.42
|
|
Epirubicin (Epi)
|
24.16
|
27.9
|
31.8
|
23.21
|
38.5
|
36.09
|
|
Capecitabine (Cap)
|
23.23
|
28.15
|
32
|
29.9
|
35.8
|
28.91
|
|
Paclitaxel (Pac)
|
11.73
|
29.9
|
32.8
|
26.2
|
24.2
|
19.3
|
Abbreviations: Ct, cycle threshold; miRNA, microRNA.
Evaluation of the Diagnostic Potential of miR-125, miR-34a, miR-21, miR-200c, and
miR221 in the Serum of TNBC Patients
MiR125 was seen to have an AUC of 0.698 (95% confidence interval [CI]: 0.548–0.847),
miR34a had an AUC of 0.524 (95% CI: 0.362–0.686), miR21 was seen to have an AUC of
0.962 (95% CI: 0. 913–1.000), miR200c had an AUC of 0.616 (95% CI: 0.447–0.785), and
miR221 had an AUC of 0.642 (95% CI: 0.486–0.799). Euclidean hierarchical complete
linkage clustering based heat map showed in [Fig. 1A] for the selected 5 circulating miRNA (miR21, miR 221, miR200c, miR125, and miR34a).
Additionally, a comparison of expression profile of miR21, miR 221, miR200c, miR125
and miR34a associated with the breast cancer precisely TNBC shown in [Fig. 1B] to [E]. After epirubicin treatment, a striking downregulation of miR125 was observed; however,
capecitabine and paclitaxel showed no comparable downregulation changes. Capecitabine
increased the expression of miRNA 125.
Fig. 1 (A) Heat map: Euclidean hierarchical complete linkage clustering based on the selected
5 circulating microRNA (miRNA), (B) Heat map of miRNA 125 of triple-negative breast cancer (TNBC) patient samples and
normal healthy control serum samples. (C) Heat map of miRNA 221 of TNBC patient samples and normal healthy control serum samples.
Ct, cycle threshold.
It was observed that paclitaxel downregulated miR200c, miR21, and miR221 ([Fig. 1A–E]). It has been observed that miR34a expression is downregulated by all three chemotherapy
drugs. Epirubicin was reported to induce the highest amount of cell death after anticancer
chemotherapeutic therapy ([Fig. 3]). Paclitaxel was shown to have the second-highest rate of cell death following anticancer
chemotherapeutic therapy ([Fig. 4]). Capecitabine caused quite minimal cell death after anticancer chemotherapeutic
therapy ([Fig. 4]) ([Table 4]). Additionally, [Supplementary Table S7] summarizes miRNAs expression and twofold change of MDA-MB-231 after treatment with
anticancer chemotherapeutic agents according to their respective IC50 dose for 24 hours
([Supplementary Fig. S2]). A differential expression profile of miR21, miR221, miR200c, miR125 and miR34a
was reported in MDA-MB-231 cell lines after the treatment of anticancer chemotherapeutic
agents ([Fig. 2B]). This study reported higher expression of miR21, miR221, miR200c, miR125, and miR34a
with epirubicin treatment in cell line system MDA-MB-231 ([Fig. 4B]).
Fig. 2 Box plot: Triple-negative breast cancer patients versus healthy controls: microRNA
(miRNA) expression in serum sample. Box-whisker plot showing Ct values and its corresponding
p-value; (A) miRNA125, (B) miRNA225, (C) miRNA200c, (D) miRNA 34a, and (E) miRNA 21, (F) Representation of miRNA expression and twofold change of MDA-MB-231 after treatment
with anticancer chemotherapeutic agents; (A) miRNA200c, (B) miRNA21, (C) miRNA221, miRNA 34a, and miRNA125b.
Fig. 3 Evaluation of the diagnostic potential of microRNA-125 (miRNA-125), miRNA-34a, miRNA-21,
miRNA-200c, and miRNA 221 in the serum of triple-negative breast cancer patients.
The therapeutic potential of miRNA-125, miRNA-34a, miRNA-21, miRNA-200c, and miRNA
221 was examined via determination of specificity and sensitivity of miRNAs in serum.
AUC, area under the curve.
Fig. 4 (A) MDA-MB-231 cell phenotype under the exposure of chemotherapeutics; Microscopic image
of MDA-MB-231 cell line pre-treatment with anticancer chemotherapeutic agent. (B) Microscopic image of cell death observed in MDA-MB-231 cell line following treatment
with epirubicin. (C) Microscopic image of cell death observed in MDA-MB-231 cell line following treatment
with paclitaxel. (D) Microscopic image of cell death observed in MDA-MB-231 cell line following treatment
with capecitabine. (B) MDA-MB-231 cluster chart.
Discussion
The purpose of this study was to assess the expression of miRNA in TNBC in patients
receiving care at a tertiary care facility in central India. Even though there have
been improvements in care strategies for breast cancer; it continues to be the biggest
contributor to cancer-related deaths in Indian women.[14] Locally advanced breast cancer and TNBC are frequently treated with neoadjuvant
chemotherapy, but the poor clinical outcome in TNBC has pushed for the development
of predictive biomarkers for early detection of TNBC and for the assessment of these
biomarkers' responses to chemotherapeutic treatment in TNBC patients because there
are so few established prognostic and predictive biomarkers.[25] Twenty-five TNBC patients who had serum samples taken before beginning neoadjuvant
chemotherapy, radiation, and surgery made up the test group. Twenty-five healthy women
who had no family history of uterine, ovarian, or breast cancer made up the control
group. The TNBC patients in this study ranged in age from 26 to 75 years old, with
a median age of 50.04 years (SD: 11.72 years). Other research done in India revealed
that patients were diagnosed with TNBC on average at 48.41 and 48.8 years old, respectively.
Despite the fact that TNBC affects women of various ages, there is no clear association
between the prognosis and the age of diagnosis.[26] The most frequent cancer now diagnosed worldwide is breast cancer.[1] In this study, 12 patients (48%) came from metropolitan areas, whereas 13 patients
(52%) came from rural areas.[27]
Lack of knowledge of breast cancer in the rural population, which is reflected in
the high mortality-to-incidence ratio, is another explanation for the discrepancy
that skews the incidence of TNBC or breast cancer as a whole toward a more urban population.[28]
[29] Here, 11 (44%) of the TNBC patients who participated in our study were premenopausal,
whereas 14 (56%) patients were postmenopausal. Family history plays a big role in
predicting the likelihood of having TNBC.[30] Only 7 (28%) of the TNBC patients in our study provided a positive family history,
while 18 (72%) of the patients provided a negative one. This is in contrast to other
research' findings, which indicated a high association between a family history of
breast cancer and its progression, particularly TNBC.[31]
[32] It can also predispose to diabetes mellitus and cardiovascular complications. In
our investigation, five (20%) of the subjects had known cases of hypertension, while
eight (32%) patients were found to have a BMI below 25. Eight (32%) of the TNBC patients
had a history of type II diabetes. Although type II diabetes and insulin resistance
are both connected to an increase in the overall incidence of breast cancer, TNBC
is less frequently associated with type II diabetes.[33]
[34] In this study, only three (12%) of the TNBC patients had involvement of the right
breast, while 22 (88%) of the TNBC patients had lesion involving the left breast.
This is consistent with Perkins et al 2004[35] and other studies[36]
[37] found that the left breast was more affected than the right breast. Additional investigation
into the physiological and immunological pathways may assist to elucidate the issue,
even though the precise source of the phenomenon is yet unknown.[38]
According to the clinical staging of the TNBC patients included in this study, 11
(44%) patients were in stage II, 3 (12%) were in stage III, and 11 (44%) were in stage
IV. Similar patterns were observed in patients reporting with clinical stage II in
studies by Nabi et al[34] and Cornier et al. 2008,[39] although in those studies the trend of patients diagnosed with stage III was noticeably
higher, the trend of patients diagnosed with stage IV was noticeably lower. This discrepancy
can be explained by the higher proportion of patients from rural areas, who often
only seek care when very ill due to ignorance and financial constraints.[40] Patients with TNBC are more likely to have lymph node involvement, and the degree
of lymph node involvement affects the course of treatment and the prognosis.[41] In this investigation, lymph nodes were involved in all 25 (100%) individuals. Studies
by Akhtar et al[27] and Nabi et al[34] also demonstrated tendencies of greater lymph node involvement in TNBC patients.
TNBC has a higher propensity for distant metastasis because of its high level of malignancy
and invasiveness. This increased propensity manifests itself in organs like the liver,
lungs, bones, and portions of the central nervous system, which has a detrimental
effect on the patient's prognosis.[40] Eight (32%) of the total patients had distant metastases upon presentation, which
is consistent with the proportion of patients with advanced clinical stages.
Circulating miRNAs are an additional, if not a substitute, diagnostic technique for
detecting breast cancer early, which opens the door for a better prognosis.[41] This is due to their distinctive expression profiles and exceptional stability in
plasma. A work by Guo et al has shown the prospect that certain circulating miRNAs
can be employed as better diagnostic biomarkers for malignant lesions of the breast
in comparison to traditionally used tumor markers like C15–3 and CEA.[42] Twenty-five women with TNBC who were receiving OPD-based treatment and 25 healthy
women were enrolled in this study.[43] Data on their ages, racial, and ethnic backgrounds, menopausal status, and family
history of breast cancer, history of pregnancies, addictions, BMI, and comorbid conditions
like hypertension, diabetes mellitus, and hypothyroidism were collected.[44] The expression of a total of five miRNAs—hsa-mir-125, hsa-mir-34a, hsa-mir-200c,
hsa-mir-221, and hsa-mir-21—in the serum samples of each patient was assessed.[45]
miRNA 125 (p< 0.0001) and miRNA 21 (p< 0.05) were found to be statistically significant among the five miRNAs examined,
with miR 125 (Δ Ct 2.77) being observed to be upregulated and miR 21 (Δ Ct -1.61)
being seen to be downregulated in patients with TNBC, respectively.[46]
[47]
[48] The miRNA 125 family plays a variety of roles by targeting various areas critical
in biological processes like the maintenance of normal homeostasis and proliferation
of immune cells, altering cell differentiation, and apoptosis, which can contribute
to tumorigenesis.[49] This is done through the process of post-transcriptional regulation of gene expression.
The findings of Wang et al[50] revealed elevated miR125b levels in breast cancer patient blood samples that were
inversely correlated with the grade of the tumor and the stage of lymph node metastasis,
among other findings. Similar to this, Nie et al study revealed that TNBC patients
had higher levels of miR125b in their blood.[51] In our study, we found that the miR125 was significantly elevated in TNBC patients,
which is consistent with the results previously indicated.
It is widely known that miR21 plays a pro-oncogenic effect.[52] By inhibiting apoptosis, miR21 has been found to be upregulated in several solid
tumors, including tumors of the gastrointestinal tract, prostatic, lung, and neuroendocrine
systems.[53] In stark contrast to previously reported findings, miR21 was shown to be downregulated
in our study (Ct -1.61, p 0.05). Further analysis is necessary because the precise
mechanism responsible for the clarification of this finding remains unclear. We also
looked at three other miRNAs: miR221 (may be tumor suppressor or oncogenic depending
on the tumor),[54] miR200c (a circulating miRNA that prevents TNBC from spreading),[55] and miR34a (whose downregulation indicates a poor prognosis).[56] MiR221 was downregulated (ΔCt -0.88), as was miR200c (ΔCt -0.71) and miR34c (ΔCt
-1.31), but these changes were not statistically significant (p = 0.086, p = 0.16, and p = 0.76, respectively). By calculating the AUC, ROC curve analysis can be used to
evaluate a possible diagnostic tool's discriminatory capacity between cases and control
data.[56] With a specificity of 0.880 and a sensitivity of 1.000, miR125 in this investigation
shown good predictive ability and had an AUC of 0.698 (95% CI: 0.548–0.847), which
is consistent with the findings of Fang et al.[57] Since miR21, an oncogenic miRNA, was observed to be downregulated, a conclusion
inferred from this data may be incorrect. MiR21 had an AUC of 0.962 (95% CI: 0.480–0.920),
which also demonstrated a strong predictive power. Therefore, more analysis is necessary
for the situation. In comparison to miR125, the AUC of miR34a, miR200c, and miR221
did not show a strong predictive power.
Monoclonal antibodies, one of the most effective therapeutic methods now available,
are ineffective in TNBC tumors due to the lack of receptors, making the use of nonspecific
cytotoxic medicines a necessity.[58] The development of chemotherapy resistance in TNBC is largely influenced by changes
in the number and structure of chromosomes, as well as gene deletions or mutations
like those in JAK2 and PTEN, immune evasion, and activation of pro-oncogenes such
PIM1.[59] Pharmacotherapeutic result in TNBC patients can be improved by composite markers
that can extrapolate chemotherapy efficacy while also predicting triple-negative malignant
lesions.[60] The expression of the five miRNA subtypes was assessed on the MDA-MB-231 TNBC cell
line after treatment with the three chosen anticancer agents, namely epirubicin, capecitabine,
and paclitaxel; in study by Wang et al,[61] and miR21 was found to be a potential biomarker for the assessment of response to
neoadjuvant chemoradiotherapy. After epirubicin treatment, a striking downregulation
of miR125 was observed; however, capecitabine and paclitaxel showed no comparable
downregulation changes. Epirubicin may have a better therapeutic effect when miR125
is downregulated because miR125 is oncogenic, but capecitabine may have a worse therapeutic
outcome when miR125 is up-regulated.[62]
Similar to how paclitaxel was observed to downregulate miR200c, miR21, and miR221,
whereas downregulation of miR200c, a tumor suppressor,[63] may negatively impact the treatment outcome and result in disease progression or
chemoresistance. In this investigation, it was discovered that all three chemotherapy
drugs reduced the activity of miR34a, a tumor suppressor[64] that may cause chemoresistance. As one of the “first of its kind” research to be
undertaken in the institute and in India, there is still a wealth of knowledge to
be learned about the patterns of miRNA expression in the Indian population.[65] Evaluation of the circulating miRNA status in TNBC patients in conjunction with
assessment of the chemotherapeutic drug's effect on the identified significant miRNAs
may offer valuable insight in predicting the prognostic and pharmacotherapeutic outcome,
which can be crucial in the formulation of a chemotherapeutic strategy tailored to
each patient's needs while minimizing the unfavorable therapeutic and prognostic outcomes.
For this hypothesis to be established and validated to improve patient care, more
research is necessary.
Conclusion
Due to their aggressive proliferation, high local infiltration, and potential for
metastasis, TNBCs are a significant cause of neoplasm-related morbidity and mortality
in women. Due to the dearth of receptors, targeted therapy is impractical, forcing
nonspecific cytotoxic chemotherapy that raises morbidity. In this investigation, TNBC
patients from central India had the expression of circulating miRNAs evaluated. We
can confirm that miRNAs are trustworthy biomarkers as a screening and prognosis prediction
tool based on blood tests that can support the already existing diagnostic modalities.
These miRNAs can aid in the formulation and improvement in the pharmacotherapeutic
strategy by forecasting pharmacotherapeutic response and the possible development
of chemo-resistance. We next assessed whether these miRNAs were up- or downregulated
in response to three widely used chemotherapeutic anticancer drugs. This study provides
some insight into the possibility of a relationship between the measurement of circulating
miRNA expression and chemotherapeutic response, which may aid in the development of
customized pharmacotherapies for the best possible patient care. However, more research
is required to establish and validate circulating miRNAs as compound biomarkers.
