Keywords
recurrent pregnancy loss - paraoxonase 1 - organophosphate - pesticides - oxidative
stress
Palavras-chave
perda de gravidez recorrente - paraoxonase 1 - organofosfato - pesticidas - estresse
oxidativo
Introduction
Recurrent pregnancy loss (RPL) is defined as the occurrence of three or more spontaneous
miscarriages. It is a diverse condition that involves various etiological factors.
Still the precise reason remains ambiguous in more than half of the cases.[1] Between 30 and 50% of conceptions are said to be missed during the 1st trimester of pregnancy. Most miscarriages occur around the time of implantation and
many times go unnoticed by the pregnant women themselves, who often mistake them for
delayed menstruations. Also, between 10 and 12% of all the clinically recognized pregnancies
end up as miscarriages during the 1st trimester.[2] Despite the fact that chromosomal abnormalities are implicated in ∼ 50% of all miscarriages,
the etiology of the other 50% is not exactly identified and may involve anatomic,
genetic, endocrine, immunological, and environmental factors.[3] Even after a complete evaluation, 50% of couples remain without a diagnosis for
their RPL. Oxidative stress is one of the crucial factors that play a prominent role
in the toxicity of various chemical families of pesticides, including organophosphate
pesticides.[4] The most largely distributed environmental toxin is pesticides. Even though each
one of us is exposed to these xenobiotics to an extent, a few people, like farmers
and floriculturists, are much more exposed to these toxins. These pesticides are extremely
noxious to humans. Considerable morbidity and mortality is associated with pesticide
poisoning, particularly in developing countries like India, where the pattern of pesticide
use is different.[5] The genetic polymorphisms as modifiers of human health diseases have gained attention
in recent years, and there is an increased interest in conducting studies to explore
the gene-environment interactions to detect susceptible populations prone to develop
health problems due to chemical exposure.[6]
Amongst the candidate genes which aim to modify vulnerability to pesticides is the
one coding for the paraoxonase 1 enzyme (PON1). The PON1 enzyme is an arilesterase
class A enzyme that catalyzes the hydrolysis of a wide range of aromatic esters and
phosphoesters, which play a multifunctional role in various biochemical pathways such
as guarding against oxidative damage and lipid peroxidation, involvement in innate
immunity, detoxification of reactive molecules, bioactivation of drugs, modulation
of endoplasmic reticulum stress, and regulation of cell proliferation/apoptosis. As
they can execute manifold self-governing and often unrelated functions, they are considered
“moonlighting proteins.”[7]
[8]
A few findings proposed that several individuals with peculiar genotypes for PON1
have low plasma levels of this enzyme.[9]
[10] The PON1 gene comprises a family which incorporates PON2 and PON3, positioned on the long arm of the human chromosome 7(q21.3–22.1). The PON1 gene contains two polymorphisms in the coding region, one in position Q192R and the
other in position L55M. The polymorphism at Q192R gives rise to two alloenzymes which
show evident difference in hydrolyzing organophosphate compounds.[11] The activity of PON1 is substrate dependent; in-vitro analysis revealed that the pace of paraoxon hydrolysis
by alloenzyme Q is slower when compared with alloenzyme R, while the rate of diazoxon
hydrolysis by alloenzyme R is lower than that of alloenzyme Q.[12] Moreover, the PON1 enzyme assists in the detoxification of certain organophosphate
pesticides (OP), which are prominent endocrine disruptors and efficiently cross the
placental barrier, influencing fetal development.[13] Certain studies have investigated the role of PON1 enzyme activity or genotype and
OP pesticide exposure on birth outcomes.[14]
[15]
[16] However, the potential association between PON1 polymorphisms, pesticide exposure, and the risk of miscarriage has not been documented.
Hence, the present study aims to evaluate the role of PON1 gene polymorphism in recurrent
pregnancy loss.
Methods
This was a case control study conducted at Queen Mary's Hospital, King George's Medical
University, Lucknow, UP, India, from January 2016 to December 2018. A total of 100
women (cases) with a history of at least three recurrent pregnancy losses before the
20th week of gestation were included in the present study. An equal number of women (100)
undergoing normal vaginal labor at term with live healthy birth were recruited for
the control group. All subjects were informed and gave written consent to participate
in the study. The present study was conducted in accordance with the guidelines set
up by the institutional Ethical committee. (ECR/262/Inst/UP/2013).
Venous blood (2 ml) was drawn from each subject at the time of recruitment and collected
in tubes with ethylenediaminetetraacetic acid (EDTA) (1mg/ml). The plasma was immediately
separated by centrifugation at 3,500rpm for 15 minutes at 4°C. The cell pack was stored
at -70°C until DNA extraction.
Genomic DNA was extracted using the phenol-chloroform method and purified DNA was
stored at -20°C until further polymerase chain reaction (PCR) analysis. The PON1 genotypes were determined by PCR amplification using primers PON1192 (forward) 5′TATTGTTGCTGTGGGACCTGAG3′; PON1192 (reverse) 5′CACGCTAAACCCAAATACATCTC3; PON155 (forward) 5′CCTGCAATAATATGAAACAACCTG3′; and PON155 (reverse) 5′ TGAAAGACTTAAACTGCCAGTC3′. The amplification cycle was performed on a
thermal cycler under the following conditions: denaturation for 5 minutes at 94°C,
followed by 30 cycles of 30 seconds at 94°C, 30 seconds at 61°C, 1 minute at 72°C
and, finally, 7 minutes at 72°C. The PCR products were digested with BspPI for P PON1192 and HinIII for PON155.
Results
Demographic Characterization
There were 100 subjects each in cases and controls group. Both groups were similar
regarding age, body mass index (BMI), source of drinking water, and socioeconomic
status. There was no significant difference in the mean age between cases and controls
(p > 0.05). There was no statistically significant difference in the sociodemographic
variables between cases and controls ([Table 1]).
Table 1
Demographical characteristics of women with RPL (case) and control women
|
Parameters
|
Cases (n = 100)
|
Controls (n = 100)
|
p-value
|
|
Maternal age (Mean ± SD) (years old)
|
25.6 ± 1.29
|
25.9 ± 1.62
|
0.48[a]
|
|
Maternal weight (Mean ± SD) (kg)
|
49.39 ± 3.44
|
51.5 ± 2.74
|
0.52[a]
|
|
BMI (Mean ± SD) (kg/m2)
|
19.64 ± 2.51
|
19.81 ± 2.76
|
0.76[a]
|
|
Food habits
|
|
|
0.42[b]
|
|
Vegetarian
|
56
|
62
|
|
Nonvegetarian
|
44
|
38
|
|
Socioeconomic status
|
|
|
0.23[b]
|
|
High
|
2
|
5
|
|
Middle
|
62
|
66
|
|
Low
|
36
|
29
|
|
Source of drinking water
|
|
|
0.76[b]
|
|
Government Supply
|
64
|
58
|
|
Private source
|
36
|
42
|
|
Place of Residence
|
|
|
0.51[b]
|
|
Rural
|
52
|
59
|
|
Urban
|
48
|
41
|
Abbreviations: BMI, body mass index; SD, standard deviation.
a Unpaired t-test.
b Chi-square test.
The PON1 gene acts as important guardian against cellular damage from toxic agents, such as
organophosphates and oxidized lipids in the plasma low-density lipoproteins.
PON1L55M Polymorphism and RPL
The genotype frequencies of PON1 L55M were conformed to the Hardy-Weinberg equilibrium
both in cases and controls. For the PON1 L55M polymorphism, the genotype frequencies
of homozygous (LL), heterozygous (LM), and homozygous mutated (MM) were 19, 21, and
60% in patients with RPL, respectively; and 35, 23, and 42% in controls, respectively.
The mutated allele (M) frequency was found in 70.5% in RPL patients and in 53.5% in
controls. Regarding the risk of development of RPL, the LL wild type genotype and
L wild type allele were taken as references. The analysis showed that the M allele
was significantly associated with an increased risk of RPL (adjusted odds ratio [ORadj] = 2.07, 95% confidence interval [CI], p < 0.001). The homozygous mutant genotype (MM) significantly increased the risk of
RPL (ORadj = 2.07; 95%CI,; p = 0.011). No significant association was observed between (LM) genotype and RPL risk
(ORadj = 0.88; 95%CI; p = 0.729). The distributions of the genotype and allele frequencies for PON1 L55M
polymorphism in patients and controls are represented in [Table 2].
Table 2
Distribution of PON1 L55M allele and genotype frequencies in RPL patients (n = 100) and control subjects (n = 100)
|
PON1 L55M polymorphism
|
Cases, n (%)
|
Control subjects, n (%)
|
Adjusted OR (95%CI)
|
p-value
[*]
|
|
Genotypes
|
|
|
|
|
|
LL
|
19 (19)
|
35 (35)
|
1.0 (ref)
|
−
|
|
LM/MM
|
81 (81)
|
65 (65)
|
2.29 (1.20–4.38)
|
0.011
|
|
LM
|
21 (21)
|
23 (23)
|
0.88 (0.45–1.73)
|
0.729
|
|
MM
|
60 (60)
|
42 (42)
|
2.07 (1.17–3.64)
|
0.011
|
|
Alleles
|
|
|
|
|
|
L
|
59 (29.5)
|
93 (46.5)
|
1.0 (ref)
|
−
|
|
M
|
141 (70.5)
|
107 (53.5)
|
2.07 (1.37–3.13)
|
<0.001
|
Abbreviations: CI, confidence interval; OR, odds ratio.
* Calculated by chi-squared test; Adjusted OR odds ratio was adjusted to the age.
PON1 Q192R Polymorphism and RPL
For the PON1 Q192R polymorphism, the genotype frequencies of homozygous (QQ), heterozygous
(QR), and homozygous mutated (RR) were 51, 41, and 8% in RPL patients, respectively;
and 46, 42, and 12% in controls, respectively. The R mutated allele frequency was
found in 28.5% in RPL patients and in 33% in controls. Regarding the risk of development
of RPL, the QQ wild type genotype and Q wild type allele were taken as references.
The analysis showed that the women who were QR heterozygotes (ORadj = 0.96; 95%CI; p = 0.887) or RR homozygotes (ORadj = 0.64; 95%CI; p = 0.480), and R allele did not show any risk for RPL (ORadj = 0.81; 95%CI; p = 0.329). The distributions of the genotype and allele frequencies for the PON1 L55M
polymorphism in patient and controls are represented in [Table 3].
Table 3
Distribution of PON1 Q192R allele and genotype frequencies in RPL patients (n = 100) and control subjects (n = 100)
|
PON1 Q192R polymorphism
|
Cases, n (%)
|
Control subjects, n (%)
|
Adjusted OR (95%CI)
|
p-value
[*]
|
|
Genotypes
|
|
|
|
|
|
QQ
|
51 (51)
|
46 (46)
|
1.0 (ref)
|
−
|
|
QR/RR
|
49 (49)
|
54 (54)
|
0.82 (0.47–1.43)
|
0.480
|
|
QR
|
41 (41)
|
42 (42)
|
0.96 (0.55–1.68)
|
0.887
|
|
RR
|
8 (8)
|
12 (12)
|
0.64 (0.25–1.63)
|
0.480
|
|
Alleles
|
|
66
|
|
|
|
Q
|
143 (71.5)
|
134 (67)
|
1.0(ref)
|
−
|
|
R
|
57 (28.5)
|
67 33)
|
0.81 (0.53–1.24)
|
0.329
|
Abbreviation: CI, confidence interval; OR, odds ratio.
* Calculated by chi-squared test; Adjusted OR odds ratio was adjusted to the age.
Discussion
The key finding of our analysis is the association between PON1 genotypes and RPL. To our information, this is the first study evaluating the outcome
of polymorphisms that are involved in the genetic variability of the PON1 enzyme on
RPL in north India. Toy et al.[17] approximated the relationship between the PON1enzyme and early loss of pregnancy
(before the 12th week of gestation) in pregnant women whose exposure to pesticides was unknown and
found out that basal and salt-stimulated paraxonase activity were significantly lower
in women who had suffered an early pregnancy failure when compared with women who
continued their pregnancy beyond the 12th week. Blanco-Muñoz et al.[18] established that the probability of miscarriage with the PON1192RR genotype was 2.2-fold higher than with the PON1192QR/ PON1192QQ genotypes. The possibility was close to 4-fold higher with the PON155MM/ PON155LM genotypes than with the PON155LL genotype.
Certain authors have documented the role of PON1 polymorphisms on other reproductive consequences, mainly gestational age, and anthropometric
measures. Chen et al.[9] reported that the probability of premature delivery increases with PON1 RR genotype
in newborns while studying the role of genetic polymorphism on pregnancy outcomes.
Lawlor et al.,[19] in a retrospective analysis, observed that the incidence of women who complained
of at least 1 spontaneous preterm delivery increased with every R allele at position
192. In Norway, Ryckman et al.[20] reported that the risk of premature birth in infants is 32% higher with the PON1–108
genotypes (OR = 1.32; 95%CI: 1.13–1.53) than in infants with PON1108CC/PON1108CT genotypes. However, no PON1 maternal genotype was related with this.
The PON1 gene exerts its role in lipid metabolism too, besides playing a major role in the
detoxification of organophosphorus compounds; the R isoform of the PON1enzyme shows
decreased capability to hydrolyze oxidated lipids.[21]
[22]
[23] On the other hand, another study established that the level of oxidative stress
increases with the QQ192 genotype.[24] Chen et al.,[9] and Lawlor et al.,[19] allocated the role of the RR genotype on preterm birth to damage in placental circulation
coupled with lipid peroxidation. Similarly, a few studies have discovered that the
presence of pesticides boosts oxidative stress and encourage the creation of oxidated
lipids.[25]
[26]
[27] Accordingly, it is feasible that the RR genotype might amplify the possibility of
low birthweight, mediated by placental hypoperfusion. All these studies cannot be
completely compared with each other as a few focused on the genotype of the mother,
while a few focused on the genotype of the infant, and others on the genotypes of
both. A few evaluated the activity of the paroxonase enzyme and a few did not pay
attention to it. In a few cases, the information on the exposure of the mother (either
occupational or via biomarkers) was accessible, but a few studies were deficient of
this variable. Nevertheless, all studies in general indicated the presence of PON1 gene polymorphism upon adverse reproductive events and imply the existence of an
interaction between miscarriage and pesticide exposure.
In contrast with a few authors who established an association between agricultural
work and miscarriage,[28]
[29]
[30] we did not find an independent effect of exposure to pesticides on the risk of RPL.
However, we did find an independent effect of maternal PON1 on the risk of RPL.
Despite its limitations, the present study is one of the first in North India to evaluate
the effect of PON1 genetic polymorphism on RPL and to provide additional evidence to the increasing
information regarding certain PON1 genotypes that may affect the development of the fetus. More research is required
to confirm these findings and overcome the limitations of the present study.
Conclusion
The reduced variability in exposure of women to pesticides might explain the absence
of association observed between the exposure and RPL. One limitation of our study
is that we have no information available on the PON1 enzyme. This is important because
even in individuals with the same genotype, this kind of activity may vary up to 13
times.[10] A large sample size might have made it possible to reach statistical significance
between the genotypes and risk of RPL, as well as to show interactions between the
genes and the environment.
